Tuber spp. as well as Imaia spp. The methods described are useful for the domestication of truffle fungi species through isolation and culturing. The domestication of major truffle species has major implications for commercially valuable truffles in reducing the time needed for truffle production. Thus, methods of growing truffle that do not require the use of soil is disclosed. In some aspects, the method establishes a pure culture of truffle fungus. In some implementations, the method grows mini-truffles. In some aspects, the method grows a known species of truffle.

The methods disclosed provide an effective and useful procedure for the successful isolation of truffle fungi. Additionally, this disclosure describes a method for the successful storage of the pure isolated fungi cultures reducing the need for constant harvesting from soil. Furthermore, methods described herewith include the cultivation of pure truffle fungi cultures on natural as well as artificial substrates and the use of such cultures as inoculums for roots to propagate the truffle fungi in fields. Additionally, the pure isolated cultures obtained by these methods may be used to create novel food products such as beverages, spreads, salad dressing, seasoning, among many others.

There are many advantages in having each of the truffle fungi in pure culture which makes them available to make a wide range of novel food related products each holding a truffle fungal flavoring after growth on a particular food product such as a grain or nut or fruit. It is to be noted that we are not aware of any organization in the world having any of these fungi in pure culture being used for the preparation of any food product.

As noted above, the only available truffle products currently available anywhere are from natural sources involving the truffle itself. Normally, pieces of truffle or slices thereof are added to cuisine via freshly harvested or dried pieces of the harvested truffle itself. And that flavor is strictly limited in scope because the fungus had been growing and obtained from only one tree source. Now, depending upon the conditions and substrates in which a fungus is grown, the secondary products that it makes are dependent upon these nutrients available for growth. In other words, having a pure culture of a fungus, as per the truffle fungi, one can grow them on a multitude of substrates and under varying conditions and that will ultimately influence the flavoring of the products made by the fungus as it modifies its hosts biochemical components. This unique feature of fungal fermentation has been taken advantage of to discover a plethora of novel potential food products that are listed here forth.

One solution to the problems involved with acquiring truffles is the prospect of isolating the fungus and simply growing it either in liquid or solid-state fermentation in the laboratory. Such methods would drastically lower all costs, especially those related to the time frame for field production. This solution is ideal since there is no reason to believe that truffles from soil growing on tree roots can have any taste or nutritional value greater than the truffle fungus grown on sterile defined or natural substrates. Commercially, this feat has not been done anywhere in the world. One of the reasons for this lack of domestication is that these truffle fungi species are not available from state or national culture collections or from university culture collections. This is due to these fungi being exceedingly difficult to isolate in pure culture. Thus, if one wishes to have a local strain available for culturing it will be important and necessary to acquire the truffle and then proceed with fungal isolation.

One of the difficulties of the process of fungal isolation is that the truffle itself is surrounded by water which is contaminated with soil-loving bacteria, other fungi and organisms making the isolation processes difficult, and in most cases impossible. Also, all of the truffle species are extremely slow growing and are easily overtaken in growth by other contaminating fungi and bacteria that inhabit the ground dwelling truffle. A successful isolating method would mean all of the expense and time spent trying to grow and recover truffles from field inoculated trees would not be necessary. The truffle fungus could be increased and made available within a few weeks having been grown on a plethora of substrates including natural ones, each of which has the prospects of providing new products to the marketplace. The potential marketplace for these truffles and their products is huge. Examples of these types of products include food and beverage items, among many possible products.

A novel and unexpected solution to the problem of truffle-fungus isolation is presented in this disclosure. Described here forth are methods that show that the isolation of virtually all of the major truffle species can be accomplished relatively quickly by a cultural selection technique involving the use of a special cocktail of volatile organic substances (VOCs) that precludes the development of soil born microbes that act as contaminants of the truffle itself. The special cocktail of VOCs is based on the VOCs naturally produced by truffle fungi, which include alcohols, esters, aldehydes, ketones, aromatic compounds, furans, alkanes, terpenoids, and, most importantly, sulfur-containing compounds. However, one must be skilled in the art of mycology in order to completely and successfully carry out this novel procedure. Ultimately, once in hand, the individual truffle species can be grown on a selection of natural substrates including grains, nuts and berries resulting in an entirely novel series of useful, enticing, and tasteful products that each represents a useful and healthful addition to the food marketplace. Such possibilities are the result of having a pure culture of the fungus obtained by the methods disclosed here.

The method of growing truffle comprises obtaining a spore-producing fruiting body of an ascomycetous fungus from soil, scraping the inside of the spore-producing fruiting body of the ascomycetous fungus to collect a fruiting body sample, placing the fruiting body sample on a first surface comprising a nutrient substrate, incubating the fruiting body sample on the nutrient substrate with an antimicrobial volatile mixture until mycelium formation, and transferring the new fungal growth into a second surface comprising the nutrient substrate to obtain a pure culture of the ascomycetous fungus. The presence of mycelium indicates new fungal growth. In some embodiments of the present disclosure, the nutrient substrate comprises: a simple sugar; a botanical isolate; and agar. In certain implementations the nutrient substrate further comprises at least one protein component, for example peptone and/or yeast extract. In some aspects, the botanical isolate is fruit, nut, grain, or a portion thereof. In particular implementations, the nutrient substrate that is potato dextrose agar. In other implementations, the nutrient substrate is pecan agar. In some embodiment of the method, the second nutrient substrate comprises a liquid. In some aspects, the nutrient substrate comprises potato dextrose.

Another embodiment of the present disclosure comprises a method of growing mini-truffles. In some non-limiting examples, a mini-truffle comprises tightly knitted small round balls in the range of 2 mm in diameter—smaller than would normally be expected of wild truffles. Some aspects comprise obtaining a spore-producing fruiting body of an ascomycetous fungus from soil, scraping the inside of the spore-producing fruiting body of the ascomycetous fungus to collect a fruiting body sample, placing the fruiting body sample on a first surface comprising a nutrient substrate, incubating the fruiting body sample on the nutrient substrate with an antimicrobial volatile mixture until mycelium formation, transferring the new fungal growth into second surface comprising the nutrient substrate to obtain a pure culture of the ascomycetous fungus, incubating the pure culture with fruit, nut, grain, or a portion thereof for at least week to produce an inoculated botanical sample, and placing the inoculated botanical sample on a third surface comprising the nutrient substrate to produce mini-truffles. The volatile organic compounds comprise compounds produced by a Muscodor spp. organism. The nutrient substrate comprises potato dextrose agar, potato dextrose broth, and pecan agar, among some non-limiting examples. In yet another aspect of the present disclosure, the third surface is pecan agar.

In yet another embodiment, the method of growing mini-truffles further comprises incubating the pure culture with fruit, nut, grain, or a portion thereof for at least week to produce an inoculated botanical sample, placing the inoculated botanical sample in a sugar solution for at least a week to produce inoculated sugar solution, and incubating inoculated sugar solution on a third surface comprising the nutrient substrate to produce mini-truffles. In some non-limiting examples, the third surface nutrient substrate comprises potato dextrose or pecan agar. In some non-limiting aspects of the disclosure, the sugar solution comprises honey or maple syrup. Some non-limiting examples of fruit, nut, grain, or a portion thereof include: rye, barley, lentil, wheat, rice, soybeans, pecan, hazelnut, pine nut, English walnut, coffee beans, mustard, cacao, sesame, sunflower, grapes, blackberries, blueberries, cherries, kiwi, mango, raspberries, and huckleberries.

In yet another embodiment, the present disclosure comprises a method of growing a known species of truffle. The method comprises obtaining a spore-producing fruiting body of an ascomycetous fungus from soil, scraping the inside of the spore-producing fruiting body of the ascomycetous fungus to collect a fruiting body sample, placing the fruiting body sample on a first surface comprising a nutrient substrate, wherein the nutrient substrate comprises: a simple sugar, a botanical isolate, and agar, incubating the fruiting body sample on the nutrient substrate with an antimicrobial volatile mixture until mycelium formation, wherein the presence of mycelium indicates new fungal growth, transferring the new fungal growth into second surface comprising the nutrient substrate and a sterile medium selected from the group consisting of: nut or a portion thereof and a grain or a portion thereof to obtain an inoculant, combining sterile water with the inoculant at a preferred volume ratio 1 part inoculant to 4 parts water to produce a suspension, mixing the suspension with a soil mixture to produce a fungal soil mixture, applying the fungal soil mixture to a plant root or a portion thereof. In some aspects, the fungal soil mixture is air dried and stored at 3° C. In other aspects the fungal soil mixture is stored at −20° C., and at −80° C. The method may further comprise mixing the fungal soil mixture with the soil in the area where roots of host trees are growing, so as to inoculate with the pure culture of the ascomycetous fungus. In an additional embodiment, a truffle-growing composition is disclosed herein. The composition comprises a grain and mycelium from a truffle species. In some aspects of the disclosure, the truffle species contains at least one of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5 and the grain is infested with the truffle species.

Another embodiment disclosed herein comprises a method for storing a pure culture of ascomycetous fungus. In some aspects, the method comprises providing sterile water, adding the pure culture of ascomycetous fungus to the sterile water to produce an inoculated solution, and storing the inoculated solution in a controlled temperature condition of 1-5° C. In another embodiment, a method for storing a pure culture of ascomycetous fungus comprises providing sterile medium selected from the group consisting of: a nut or a portion thereof and a grain or a portion thereof, inoculating the sterile medium with the pure culture of ascomycetous fungus to produce an infested seed population of ascomycetous fungus, and storing the infested seed population of ascomycetous fungus in a controlled temperature condition. In some aspects of the disclosure, the controlled temperature condition is −80° C. to −20° C. In some other aspects of the disclosure, the controlled temperature condition is 20° C. to 25° C., the method further comprises drying the seed population of ascomycetous fungus.

In still yet another embodiment, a method of making a truffle-flavored food product is herein disclosed. The method comprises incubating a pure culture of ascomycetous fungus with fruit, nut, grain, or a portion thereof for at least two weeks to produce an inoculated botanical sample and processing the inoculated botanical sample into a food product. In one aspect of the embodiment, the processing step of the method comprises at least one of: drying the product, grinding the inoculated botanical sample into a powder and creating a wet mash using the inoculated botanical sample and/or using the wet product in combination with some other product such as honey or maple syrup. In another aspect of the present disclosure, the powder or mash is mixed with a food product. In some non-limiting examples of food products, the powder or mash is used to create salts, oils, dressings, spreads, and drinks. The cultured truffle fungi can provide useful new food products and flavors when in a cultivated state.

Volatile Organic Compounds Mixture

In some embodiments of the present disclosure, the antimicrobial volatile mixture is derived from the volatile organic compounds produced by a Muscodor spp. organism.

About 20 years ago a novel but related ascomycete (M. albus) was isolated whose volatiles (VOCs) were lethal as well as inhibitory to many other microbes. This fungus was making volatile antibiotics, and some compounds were identical or related to those of the truffle fungi. Thus, the concept applied in this disclosure is that it is understood that a fungus species exists that does not kill itself nor its related ascomycetous (VOC-producing) fungal species could possibly kill or severely inhibit contaminating microbes that inhabit the truffle. It seemed likely that one could develop a technique that would readily allow for the virtual decontamination of the truffle without killing the fungus that made it and eventually allow for it to grow out on its base medium. Subsequently, another Muscodor sp. was isolated that made fewer VOCs and was just as active as M. albus. Thus, the selection technique for the truffle fungi is based on the VOCs of the new Muscodor, named Muscodor crispans. A further explanation of this procedure is given below.

The background information on the unique approach is based on the discovery of a novel endophytic fungus, Muscodor albus, and its related species. It has been learned that each of these species produces one or more biologically active volatile organic compounds that various targets, from insects to microbial organisms. Artificially prepared mixtures of these fungal-produced compounds all have the ability to mimic the biological effects of the fungus itself. This organism is one of the most effective biological weapons that has ever been found.

The Muscodor genus has 22 type species recognized as of 2023, and several isolates reported from the different geographic locations across the globe which are being continuously exploited for the development of numerous industrial applications. Some areas of industrial application include the agriculture sector followed by health, environment, and food. Members of Muscodor genus are some of the best studied fungi with respect to their gas chemistry (VOCs) which possess tremendous direct and indirect applications. All isolates have been found as endophytes and, for the most part, each possesses antimicrobial properties in the VOC stage using a well-established bioassay system. Furthermore, the chemistry of the VOC mixture is unique with respect to every individual Muscodor species that has been described.

Muscodor albus, the first isolate of Muscodor, released up to 37 different VOCs. An artificial mixture of at least 18 of these VOCs was prepared by organic synthesis, as well as product purchase and ultimately made into a mixture that closely mimicked the bioactivity of the fungus itself. The mixture had broad spectrum activity against a wide range of fungi but commonly Trichoderma spp. were relatively unaffected. Therefore, concerted efforts were made to find other species of this fungus having fewer VOCs but still having strong antimicrobial activities. The original fungus was used as a selection tool for these purposes. To this end, a novel Muscodor species appeared from a wild pineapple plant recovered from the reaches of the upper Amazon River Basin in Bolivia. The fungus was named Muscodor crispans and it was shown to produce only 17 VOCs and at least 5 of them were deemed as either non-essential to bioactivity or having questionable human and or environmental safety risks including such molecules as ethanol, ethyl acetate, formamide, N-(1-methylpropyl)-, cyclohexane, 1,2-dimethyl-3,5-bis(1-methylethenyl), and hexane, 2,3-dimethyl-D. Subsequently an artificial mixture of the remaining 12 compounds was made and tested and shown to be extremely active against a wide range of plant and human pathogenic fungi and bacteria. This mixture of Muscodor crispans VOCs was given the name of B-23 after the original designation of the place and the plant number given to the wild pineapple plant. Thus, this is how the B-23 mixture was discovered and now being applied as a key ingredient to isolate various Tuber spp. fungi (Table 3). The method was successfully applied to the isolation of truffle fungi belonging to the Imaia spp.

Thus, in some aspects, the antimicrobial volatile mixture comprises at least one of: propanoic acid, 2-methyl-, methyl ester; ethanol; acetic acid, 2-methylpropyl ester; propanoic acid, 2-methyl-, 2-methylpropyl ester; 1-propanol, 2-methyl-; 2-butenal, 2-methyl-, (e)-; 1-butanol, 3-methyl-, acetate; propanoic acid, 2-methyl-, 2-methylbutyl ester; 1-butanol, 3-methyl-; propanoic acid, 2-methyl-, or isobutyric acid; and acetic acid, 2-phenylethyl ester.

Truffle Species

The species of truffle to which the disclosed methods may be applied includes a Tuber spp. and Iamai spp. For example, the disclosed method grows a species of ascomycetous fungus selected from the group consisting of: Tuber melanosporum, Tuber magnatum, Tuber aestivum, Tuber uncinatum, Tuber borchii, Imaia spp., Tuber macrosporum, Tuber gibbosum, Tuber oregonense, and Tuber lyonii syn. Texense.

Briefly, some of the characteristics of isolated Tuber melanosporum or the black truffle are:

- 1. Relatively slow growth on PDA medium of 1 mm per day.
- 2. Production of slightly yellowish hyphae that become heavily interwoven.
- 3. Immediate production of fused hyphae into synnemata (fruiting structures).
- 4. Abundant production of conidiospores (conidia) on synnemata that are about 2.5 μ in diameter (FIGS. 3, 4). Initially the spores are produced on the termini of branched conidiophores. Then on older synnemata they bud from the entire length of that structure (FIGS. 3,4).
- 5. Initial colony color is yellowish white eventually tuning gray then to black.
- 6. Older colonies turn grayish as a result of numerous synnemta and conidiophores and conidia (FIG. 5).
- 7. Definite truffle odor developing on the colonies. This odor is the result of the production of volatile organic compounds (VOCs) by the fungus. GC/MS analyses have been published for the black truffle as well as many of the other truffle fungi. The compounds identified by the standard SPME fiber analyses have revealed the presence of sulfur compounds, organic alcohols, acids, esters, aldehydes, ketones, as well as aromatic compounds, furans, terpenoids and others. It is to be remembered that all of the analyses published thus far in the literature were done on the intact truffle material and not on pure fungal cultures and that all truffles are made up of a huge complex mixture of microorganisms including bacteria, other fungal species, streptomycetes and even an occasional insect, not to mention plant tissue material on which the truffle forms. Thus, one would expect that a GC/MS analysis of a pure truffle culture would not be identical to that of the respective truffle type that it may produce since fungal products would and could be easily modified by the other microbes in the truffle tissues. This would yield a mixture of mostly bacterial and other fungal derived products. Nevertheless, GC/MS analyses of the VOCs of the black truffle culture did yield the following compounds that were common to published analyses of the black truffle itself including acetic acid, ethyl benzene, nonanal, decanal, ethyl benzene, 1,24 trimethyl benzene, and benzaldehyde. Most importantly was the detection of 3-thiophencarboxylic acid methyl ester. Thiophenes are known products of the truffle fungi. These products were found in samples obtained from 4- to 5-week-old cultures of the fungus having been grown on white rice as described below. Gases were sampled with the SPME fiber as well as solubilized gaseous compounds analyzed with the C8 solid phase extraction cartridge. The GC/MS data are supportive of the claim that the black truffle fungus has been successfully isolated. Obviously not all of the volatile compounds published for the black truffle were recovered here since the truffle represents a microbiome of many microbes and other organisms and they undoubtedly contribute to the complexity of the VOC composition, independently of the Tuber spp.
- 8. Eventual formation of mini-truffles on PDA plates. The fungus had been grown on sterile pecan fruits for 6 weeks and then placed in honey for 1 week. It was then struck on PDA and grown for a year on the plate where it produced mini-truffles (FIG. 4). Also, when a culture is transferred from PDA to the pecan agar, mini-truffle formation begins in about 6 weeks. This is, to our knowledge, the first report of such a discovery. It has major implications as another commercial product-that is artificially derived truffles.
- 9. The ITS sequence of the T. melanosporum is provided in SEQ ID NO: 1. It shares 99.8% identity with Cosmospora sp. but in no way is it identical to this fungus. Interestingly, in the literature, virtually all of the ITS sequences reported for the truffle fungi had their DNA extracted from the truffle itself which is composed of plant, other fungal and bacterial contaminants (11). Thus, one cannot obtain a valid determination of the actual ITS sequence in this manner. Only a pure fungal culture as a DNA source can yield accurate ITS sequence information as per above.

Some of the characteristics of the white truffle (Tuber magnatum) are described below:

- 1. Relatively slow growth on PDA medium of 1.1 mm per day.
- 2. Production of slightly hyaline hyphae leading to whitish mycelia growth.
- 3. Immediate production of fused hyphae into synnemata (fruiting structures).
- 4. Abundant production of conidiospores (conidia) on conidiophores and multiple conidiophores (synnemata) that are dimorphous, some in the range of about 3.0 μm in length and other that are two celled and longer at about 6.7 μm (FIG. 5). Initially, the spores are produced on the termini of branched conidiophores and during the fixation processes the conidia break off from the conidiophores and leave scarred ends of these structures (FIG. 5 insert).
- 5. Initial colony color is white eventually with portions tuning tan to brownish.
- 6. Older colonies turn dark brown.
- 7. Definite truffle odor developing on the colonies.
- 8. Eventual formation of mini-truffles pecan agar plates at 1-2 weeks.
- 9. The ITS sequence of T. magnatum is provided in SEQ ID NO: 2. It is not identical to any of the other truffle species.

Additionally, some of the characteristics of the summer truffle (Tuber aestivum) are described below:

- 1. Relatively rapid growth on PDA medium of 2.8 mm per day.
- 2. Production of hyaline hyphae leading to a white mycelium that forms interwoven rope like strands.
- 3. Production of conidiophores and then synnemata and many arthrospores (conidia). The spores are truncated, and barrel shaped with an average length of 5.2 μm and width of 3.5 μm (FIG. 6).
- 4. Older colonies stay whitish.
- 5. An initial fruit like odor developing in the culture plates.
- 6. Mini-truffles production in 2-3 weeks on the pecan agar.
- 7. The ITS sequence of T. aestivum is provided in SEQ ID NO: 3. It shows 98% sequence identity to Geotrichum which also makes arthrospores, but it is not a Geotrichum by all other indications.

Characteristics of the burgundy truffle (Tuber uncinatum) are shown below:

- 1. Relatively slow growing at 1.0 mm per day.
- 2. Production of hyaline hyphae eventually growing into a white mycelium that forms interwoven rope like strands.
- 3. Production of synnemata with abundant conidia born on conidiophores. The conidia are oddly shaped but do average 3.6×9.2 μm in size (FIG. 8).
- 4. After several weeks on PDA the culture medium begins to turn a burgundy color which supports the name of this interesting truffle.
- 5. At 4-5 weeks on pecan agar the fungus begins to make mini truffles that are whitish and small and having an erumpent surface just as the mature naturally harvested older truffles—i.e., 0.3 mm. Scanning electron micrographs show the formation of a nice pellicle layer over the mini truffle surface.
- 6. The cultures of this fungus commonly form a greasy appearance because of the huge number of conidia that are formed. The mycelium remains whitish over many months.
- 7. The ITS sequence of T. uncinatum is provided in SEQ ID NO: 4. It is not related to any of the other truffle fungi.

Some of the characteristics of the whitish truffle fungus (Tuber borchii) are described below:

- 1. Relatively rapid growth on PDA medium of 3.0 mm per day.
- 2. Production of hyaline hyphae eventually growing into a white mycelium that forms interwoven rope like strands.
- 3. Production of conidiophores with conidia on termini of branches and then synnemata and many arthrospores (conidia). The spores are truncate and barrel shaped with an average length of 5.6 μ and width of 4.0 μ (FIG. 7).
- 4. Older colonies stay whitish.
- 5. An initial fruit like odor developing in the culture plates.
- 6. Mini-truffle production in 2-3 weeks on pecan agar.
- 7. The ITS sequence of T. borchii is provided in SEQ ID NO: 5. The sequence is very closely related to the sequence of T. aestivum but not to the other truffle fungi as per T. melanosporum (above).

Characteristics of the North American truffle fungus (Imai sp.) are described below:

Imaia is a fungal genus in the family Morchellaceae found in Japan, and in the Appalachian Mountains of the US. A monotypic genus, Imaia was circumscribed in 2008 by James Martin Trappe and Gábor M. Kovácsto to contain the truffle-like species formerly known as Terfezia gigantea when molecular analysis demonstrated that its DNA sequences were markedly different from those of Terfezia. The fruit bodies of Imaia gigantea are spherical to roughly elliptical to irregular in shape, brown, and usually develop cracks in age. The interior gleba comprises brown pockets of asci separated by white veins. The spores are spherical or nearly so, up to 70 μm long, and enclosed by a thick epispore.

After isolation and examination, it showed the following characteristics:

- 1. Hyaline hyphae growing on PDA at a rate of 2.5 mm per day at 22° C.
- 2. Producing a totally whitish mycelium not developing any pigmentation over several months held on PDA.
- 3. It produced whitish mini-truffles 3-5 mm in diameter on pecan agar after two weeks of incubation at 22° C.
- 4. It produced a mixture of a wonderfully aromatic mixture of volatile organic compounds after a week having been grown on PDA.
- 5. It produced an abundance of synnemata on PDA and the conidiospores (arthrospores) associated with the synnemata resembled (in size and shape) those of both T. aestivum and T. borchii (FIG. 6 and FIG. 7).
- 6. The fungus was fermented on Thompson seedless grapes as well as ground pecans for two weeks at 22° C. The decanted filtered grape juice was given a ranking of 8.5 whilst the unfermented juice was ranked at 6.0 (see Table 7 below). Also, the fungus product from pecans was dried and ground. It produced a powder with a nice truffle taste having a pecan tasting background (see Table 5 below).
- 7. This truffle fungal isolate can be saved by growing it on sterilized white rice grains for several weeks and then putting them in cryovials and placing them at −80° C. or placing the conidiospores in vials with sterile water and storing at 2-3° C. (see section on storage below).

Table 1 provides brief description of commercial truffle species. Table 2 lists ITS sequences for pure culture of truffle. Each of the truffle fungi described in Tables 1 and 2 were originally obtained, as freshly harvested truffles, from their natural geographic sources and then used as a biological source of the pure cultures once these organisms were successfully isolated.

TABLE 1

Brief Description of Truffle Species

Common Name
Species
Brief Description

Black Truffle
Tuber melanosporum
The black truffle or black Périgord

truffle, the second-most commercially

valuable species, is named after the

Périgord region in France. Black truffles

associate with oaks, hazelnut, cherry, and

other deciduous trees and are harvested

in late autumn and winter.

White Truffle
Tuber magnatum
This high-value white truffle (tartufo

bianco d'Alba in Italian) is found mainly

in the Langhe and Montferrat areas of the

Piedmont region in northern Italy, and

most famously, in the countryside around

the cities of Alba and Asti. A large

percentage of Italy's white truffles also

come from Molise.

Summer Truffle
Tuber aestivum
The black summer truffle is found across

Europe and is prized for its culinary

value.

Burgundy Truffle
Tuber uncinatum
Burgundy truffles (designated Tuber

uncinatum) are harvested in autumn until

December and have aromatic flesh of a

darker color. These truffled associate

with various trees and shrubs.

Whitish Truffle
Tuber borchii
The “whitish truffle” is a similar species

native to Tuscany, Abruzzo, Romagna,

Umbria, the Marche, and Molise. It is

reportedly not as aromatic as those from

Piedmont, although those from Città di

Castello are said to come quite close.

An Appalachian
Imaia spp.
This species is found in very limited

truffle

areas in the Appalachian Mountains of

Eastern USA.

“garlic truffle”
Tuber macrosporum
Less common truffle.

Oregon black truffle;
Tuber gibbosum;
Notable U.S. Pacific Northwest species

Oregon spring white
Tuber oregonense
of truffles, among several species of

truffle

truffle harvested both recreationally and

commercially.

Pecan truffle
Tuber lyonii syn. Texense
Found in the Southern United States,

usually associated with pecan trees.

Chefs who have experimented with them

agree “they are very good and have

potential as a food commodity.”

TABLE 2

ITS Sequences for Isolated Truffle Fungi

SEQ ID NO
Truffle Species
ITS Sequence

SEQ ID NO: 1
T. melanosporum
CCTGTGACATACCTATTGTTGCTTCGGCGGGATCGCCC

CGGCGCCCTCGGGCCCGGACCCAGGCGCCCGCCGGA

GGACCCAAACTCTTGTCTTCATGAGAATCTTCTGAGT

AACACAAGCAAATAAATTAAAACTTTCAACAACGGAT

CTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAAT

GCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCA

TCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCT

GGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCA

AGCCCCCGGGCTTGGTGTTGGGGATCGGCCGCCCTCC

GGCGCGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTG

TAGCCTCCTCTGCGTAGTAACACACCTCGCACCGGAA

CGCAGCCTGGCCACGCCGTTAAACCCCCCACTTCTGA

AGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAAC

TTAAGCATATCAATAAGCGGAGGAA

SEQ ID NO: 2
T. magnatum
CCCTGTGACATACCATATTGTTGCCTCGGCGGTGCCTG

TTTCGGCAGCCCGCCAGAGGACCCAAACCCTAGATTA

CATTAAAGCATTTTCTGAGTCAATGATTAAATCAATC

AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCG

ATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAA

TTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCA

CATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTC

CGAGCGTCATTTCAACCCTCAAGCCCCCGGGCTTGGT

GTTGGAGATCGGCGAGCCCCCCGGGGCGCGCCGTCTC

CCAAATATAGTGGCGGTCCCGCTGTAGCTTCCTCTGC

GTAGTAGCACACCTCGCACTGGGAAACAGCGTGGCCA

CGCCGTAAAACCCCCCACTTCTGAAAGGTTGACCTCG

GATCAGGTAGGAATACCCGCTGAACTTAAGCATATCA

ATAAGCGGAGGAA

SEQ ID NO: 3
T. aestivum
GTGANTTACACNGCAACAATAATTTTATANTCAAANA

CNNAAAATAATCAAAACTTTTAACAATGGATCTCTTG

GTTCTCGTATCGATGAAGAACGCAGCGAAACGCGATA

TTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGA

ACGCACATTGCACTTTGGGGTATCCCCCAAAGTATAC

TTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCATTGCT

TTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAA

CACTATTCAACCTCAGATCAAGTAGGATTACCCGCTG

AACTTAAGCATATCAANNNGCGGAGG

SEQ ID NO: 4
T. uncinatum
ACTATATCCATCTACACCTGTGAACCGTTTGATTGAAT

CTTCTGATTCAATTTTACAAACATTGTGTAATGAACGT

CATTAGATCATAACAAAAAAAAACTTTTAACAACGGA

TCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAA

TGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATC

ATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTC

CGGAGAGCATGCCTGTTTGAGTGTCATGAAATCTCAA

CCATTAGGGTTTCTTAATGGCTTGGATTTGGAGGTTGC

CATTCTAAATGGCTCCTCTTAAAGGAGTTAGCAAGTT

TTACTATTGCTATCTGGCGTAATAAGTTTCGCTGGAAT

GGTATTGTGAAGCGTGCTTCTAATCGTCTTCGGACAA

TTACTTTGACTCTGGCCTCAAATCAGGTAGGACTACC

CGCTGAACTTAAGCATATCAATAAGCGGAGGAA

SEQ ID NO: 5
Tuber borchii
TTGTGATTTACCACAGCAACAAAAATCATACAATCAA

AACAAAAATAATTAAAACTTTTAACAATGGATCTCTT

GGTTCTCGTATCGATGAAGAACGCAGCGAAACGCGAT

ATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTG

AACGCACATTGCACTTTGGGGTATCCCCCAAAGTATA

CTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCTTTGCT

CTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAA

CACTATTCAACCTCAGATCAAGTAGGATTACCCGCTG

AACTTAAGCATATC

Basically stated, each of the many truffle fungi listed above are now available in pure culture. These truffle fungi can now be grown on a plethora of natural or artificial media which will make available an untold number of possible novel products each with a different set or combination of flavors. That is, since the fungus has been provided with different substrates on which to grow thus converting substances in the growth source to other flavor-like compounds and combinations thereof. Likewise, the isolation procedure will readily allow for the recovery of numerous local strains of the fungus which may prove useful in finding stand alone and unique natural foods. In this case, novel flavors can be created by actually growing the truffle fungus on grains, nuts, powders, floral parts or literally natural food source or mixtures of such products.

Presently, trees are inoculated with the truffle fungi by dipping the roots into a puree of the truffle fungus that is desired. This is a costly, unsatisfying, and non-scientific proposition since the truffles themselves are not containing a myriad of infectious conidiospores and are contaminated with a plethora of other fungi and bacteria all of which portend of unexpectedly poor and undesirable outcomes. However, now with pure cultures of many truffle fungi can be easily grown on sterile grains such as de-hulled barley, rye, wheat or rice wherein there is an abundant production of infectious conidiospores (FIG. 11). These grains, after two-3 weeks of fungal growth can be dried under aseptic conditions at room temperature and stored under refrigeration (freezing or 40° F.) or at room temperature (22° F.) for up to a year with no significant decline in viability (FIG. 13). Subsequently, these infested grains can be used as inoculum for plant roots by placing them near to the roots of the desired plant species that will serve as the host.

EXAMPLES

The present disclosure is further illustrated by the following examples that should not be construed as limiting. The contents of all references, patents, and published patent applications cited throughout this application, as well as the Figures, are incorporated herein by reference in their entirety for all purposes.

Example 1. Isolation Procedures for Major Truffle Species for Domestication

The isolation of an individual targeted truffle species was initiated by locating it fresh from a commercial intact truffle source. The truffles were cleaned, rinsed, dried and forwarded to our Montana address by rapid delivery services. The procedure described below is applied best to intact truffles. The truffles were stored, wrapped in paper toweling, and stored at refrigerator temperature. Each truffle was cut and then torn open. The freshly exposed surfaces were scraped into small, approximately 0.5-2 mm pieces directly onto a Petri plate containing potato dextrose agar (PDA) (FIGS. 1 & 2). A detached top cap lid from a small microcentrifuge vial was placed on the center of the plate. The lid then had 10 microliters of the B-23 solution added to it. The composition of B-23 is described in Table 3. The B-23 patented product mixture is available through Jeneil Biotech Co. Saukville, WI. The truffle pieces were liberally distributed around the plate (FIG. 2). The plates were incubated for 3-4 days at 22° C. and, at that point, it was noted that some microbial growth appeared well away from the center well but not immediately next to the center well. After 5 days of incubation, one could begin to carefully pick mycelial fragments of fungal colonies that appeared to be Tuber spp. Those fungal colonies having synnemata were especially targeted for transfer. The transfer of colonies was done with a sterile sharp knife tip. Also, the Petri plate lid was removed (degassed) and the cover returned to the plate. Over the course of several more days those particles next to the well were closely examined for fungal growth. Once growth occurred, the agar pieces containing fungal hyphal tips were carefully picked and transferred to new PDA Petri plates. Any remaining bacterial contaminants were removed by placing small amounts of powdered tetracycline HCL over the culture. Fungi suspected of being Tuber spp. were then examined for their ability to produce synnemata, asexual spores, pigments and the classic truffle odors. The entire process requires one skilled in the art of fungal biology and in particular truffle fungal biology to be able to correctly distinguish these fungi. The first Tuber sp. to be isolated in this manner was Tuber melanosporum. The isolates met all the culture and morphological characteristics of that particular fungus as described above.

TABLE 3

GC/MS analysis of the volatile compounds produced by

M. crispans. Several minor peaks and the breakthrough

peak were omitted from the total analysis since they

represent only 1% of the total area. Compounds found

in the control PDA plate are not included in this table.

Retention

Time
Total

MW

Min.
Area
Possible Compound
Da

2:05
1.39
Acetaldehyde *+
44.03

3:40
6.23
Ethyl Acetate *+
88.05

3:51
2.83
2-Butanone *+
72.06

4:08
30.56
Propanoic acid, 2-methyl-, methyl ester *
102.07

4:18
12.41
Ethanol *
46.04

5:29
2.29
Acetic acid, 2-methylpropyl ester *
116.08

6:39
1.09
Propanoic acid, 2-methyl-, 2-
144.12

methylpropyl ester *

6:46
1.78
1-Propanol, 2-methyl- *
74.07

6:52
1.51
2-Butenal, 2-methyl-, (E)- *
84.06

7:12
4.79
1-Butanol, 3-methyl-, acetate *
130.10

8:18
3.01
Hexane, 2, 3-dimethyl-#+
114.14

8:21
4.78
Propanoic acid, 2-methyl-, 2-methylbutyl
158.13

ester *

8:31
5.38
1-Butanol, 3-methyl- *
88.09

13:37
351.18
Propanoic acid, 2-methyl- *
88.05

14:41
3.94
Formamide, N-(1-methylpropyl)-+
101.08

16:44
1.31
Acetic acid, 2-phenylethyl ester *
164.08

20:44
7.20
Cyclohexane, 1,2-dimethyl-3,5-bis(1-
192.19

methylethenyl)-+

* Denotes that the indicted compound had the same retention time (RT) and mass spectrum (MS) as an authentic standard. Also indicates that the compound was used in the artificial mixture of VOCs. All other compounds in the list are matched to the most likely compound in the NIST data base, but the data have not been confirmed by use of an appropriate identical standard compound by either retention time or MS.

#Denotes that the authentic standard did not have the same retention time as the compound indicated.

+Denotes not used in the B-23 formula mixture. The B-23 mixture is made by adding each of the components shown in this figure as a volume amount taken from the total area calculation in this table. Propanoic acid has been substituted for isobutyric acid at 13.37 min. because of the rancid nature of this acid.

To isolate a pure culture Imaia spp., a shipment of about 1.5 kg of freshly harvested truffles were obtained from a grower in North Carolina. One of the truffles was rinsed with a spray of 70% ethanol and air dried. Then a sharp sterilized blade was inserted into the flesh of the truffle, and it was broken along the line of the inserted blade to reveal an untouched internal truffle surface. The sterile blade tip was also used to remove pieces of truffle flesh on to a Petri plate (PDA). At the center of the plate was placed a small plastic well containing 10 μl of the B-23 mixture and the plate was sealed with two wrappings of parafilm. The plate was set to incubate for 4 days at 22° C. At the end of that time only one fungal colony had grown out of the truffle fleshy pieces. The colony was labeled NC-1 and struck on other PDA plates and checked for cultural purity. The culture had the promising qualities of being another pure culture isolate of a truffle fungus. After further examination it showed the characteristics described above.

Materials and Methods
1. Mini-Truffles and Pecan Agar

This agar was made and tested because T. melanosporum was grown on ground pecans for 6 weeks, then placed in honey for 1 week to kill the fungus, and then spread on a PDA plate to determine if killing had occurred. Very unexpectedly, the fungus seemed to round up into little balls of mycelium within a week and then after 1 year the little balls appeared as mini-truffles, that is tightly knitted small round balls in the range of 2 mm in diameter—visible to the eye but smaller than normally expected from wild truffles. In comparison, on regular agar PDA the fungus only grew as flat mycelium and no mini-truffles have ever appeared. Thus, it seemed that the ingredients in the pecan were able to induce mini-truffle formation in this fungus. Therefore, a special pecan agar was concocted to be used as a substrate to learn if it alone would induce truffle formation in each of the putative truffle fungi. If this were the case, then this medium could serve as a test medium to ascertain if any putative fungus may be a truffle fungus and thus serve as an additional supportive information for the identity of the organism.

The ingredients of the pecan agar are below:

10
g
finely ground pecans

2.5
g
glucose

0.5
g
peptone

1
g
yeast extract

3
g
agar

Make up to 200 ml of water and autoclave for 20 min.

Pour plates with 35 ml of fluid.

The plates are then inoculated with a pure culture of each of the truffle fungi.

The plates were incubated for 2-3 weeks at 22° C. and then photographed at that point in time when mini-truffles began to appear.

2. Scanning Electron Microscopy (SEM)

SEM was performed on the truffle isolates having been grown on the pecan agar (see below) for varying periods depending upon the given isolate. Agar pieces supporting fungal growth were placed in filter paper packets then placed in 2% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.2-7.4) with Triton X 100, a wetting agent, aspirated for 5 min and left overnight. The next day they were washed in six 15 min changes in water buffer 1:1, followed by a 15 min change in 10% ethanol, a 15 min change in 30% ethanol, a 15 min change in 50% ethanol, five 15 min changes in 70% ethanol, and were then left overnight or longer in 70% ethanol. They were then rinsed six times for 15 min in 95% and then three 15 min changes in 100% ethanol. The microbial material was critical point dried using a Tousimis Autosamdri® 931 GL critical point dryer, sputter coated with AuPd (80:20) using a Quorum Q 150T ES sputter coater, and images were recorded with a ThermoFisher Apreo C SEM. Hyphae were measured using Image J software (available online: rsb.info.nih.gov/ij/).

3. ITS—DNA Sequencing of the Truffle Fungi

DNA extraction—A quick DNA extraction method was used to acquire genomic DNA from the fungal isolates. Mycelium was picked up with the help of a sterile pipette tip and transferred to a 0.2 ml Eppendorf tube containing 15 μl of Kawasaki lysis buffer (10 mM Tris HCl pH 8, 1 mM EDTA, 0.5% Tween 20, 10 μg/ml Proteinase K) and 15 μl of ultrapure water, followed by a 15 minutes incubation at 85° C. After the incubation time, tubes were centrifuged for 1 minute at 10000 rpm. DNA was extracted in replicates of two per fungal isolate.

PCR method—Fungal DNA was amplified using the rRNA gene primers ITS1F and ITS4R (9). PCR reactions (20 μl) was performed in 0.2 ml Eppendorf tube and contained 2 μml of template DNA, 10 μl of 2× PCR Hot Start Green Master Mix, and 500 nM of each primer. PCR thermocycler conditions consisted of an initial denaturation step of 95° C. for 5 minutes, followed by 35 amplification cycles of 95° C. for 30 s, 55° C. for 30 s, 72° C. for 60 s, and a final extension step of 72° C. for 10 min. All reactions were done in duplicate. Amplification was visualized in 1% agarose gel stained with GelRed® nucleic acid gel stain, at 10000×.

PCR products were purified and Sanger sequenced at Genewiz/Azenta in New Jersey. Sequencing results were blasted against the NCBI database. Ms. Erica Consoli of MSU performed these analyses.

4. Gas Chromatography/Mass Spectroscopy of Tuber spp. Volatiles (VOCs)

A solid-phase micro-extraction syringe was used for trapping the fungal truffle volatiles (in the gas phase) that followed the procedure used to analyze the VOCs of Muscodor albus. The fiber material (Supelco) was 50/30 divinylbenzene/carburen on polydimethylsiloxane on a stable flex fiber. The syringe was placed through a small hole drilled in the side of the Petri plate and exposed to the vapor phase for 45 min. The syringe was then inserted into a gas chromatograph (Agilent 8890) equipped with a mass-selective detector. A 30 m×0.25 mm i.d. 5% phenyl methylpolysiloxane (HP-5 ms) Agilent J&W capillary column with a film thickness of 0.25 μm was used for the separation of the volatiles. The column was temperature programmed as follows: 25° C. for 2 min, then increased to 220° C. at 5° C. min⁻¹. The carrier gas was helium (ultra high purity (UHP); local distributor) and the initial column head pressure was 50 kPa. The helium pressure was ramped with the temperature ramp of the oven to maintain a constant carrier gas flow velocity during the course of the separation. Prior to trapping the volatiles, the fiber was conditioned at 240° C. for 20 min under a flow of helium gas. A 30 s injection time was used to introduce the sample fiber into the gas chromatograph. The chromatograph was interfaced to an Agilent 7000D triple quadrupole mass spectrometer operating at a mass resolution of 1500. The mass spectrum was scanned at a rate of 0.50 s per mass decade over a mass range of 35-360 Da. Data acquisition and data processing were performed on the Agilent Mass Hunter software package. Initial identification of the unknowns produced by the fungus was made by library comparison using the NIST database.

Analysis of compounds with a lower concentration in the vapor phase was achieved by growing the fungus on a rice/water slurry. The water extract from this mixture (25 mL) was filtered through Whatman number 2 paper then applying the solution to a C8 solid phase extraction cartridge (Silicycle™ brand, 500 mg). This C8 cartridge was prepared before use by passing 15 mL of HPLC grade methanol through the cartridge followed by 20 mL of HPLC grade water. The fungal extract was observed to adhere to the stationary phase by a color change. The cartridge was then washed with 20 mL of HPLC grade water under vacuum in a solid phase extraction manifold. Air was drawn through the cartridge for 5 minutes after loading to remove excess water. The compounds retained on the cartridge were eluted by adding 5 mL of HPLC grade methanol and collecting to eluant in a three-dram vial. One mL of this eluant was placed in a GC vial which was capped and analyzed using the temperature program and process described above. Dr. James Harper of BYU performed these analyses.

Example 2. Storage of Isolated Truffle Species

One critical requirement for the domestication of these truffle fungi is the ability to successfully store them for recovery and future use. Many techniques are available for this purpose and several of the standard procedures were tested. The isolated truffle species were tested and the techniques described below resulted in successful storage of these isolated cultures.

1. Storage in Sterile Water at Refrigerator Temperatures

Two- to three-week-old cultures of each of the truffle fungi, growing on PDA potato dextrose agar, had the surface of the agar plate scraped with a bacterial loop. The spores and hyphal fragments picked up by the loop were then placed by shaking into a small vial containing about 1 ml of sterile distilled water. The vial was then capped and placed at 3° C. for various time periods. Subsequently, a loop was reinserted into the spore suspension and spread over the surface of a freshly prepared plate of PDA. The isolates of T. melanosporum and T. borchii showed growth on the plates within 2 days after having been stored for over 1 year. The isolates of T. aestivum, T. magnatum, T. uncinatum and Imaia spp. all showed positive growth after storage for 3 months and even up to 1 year. This technique is a promising one for keeping viable cultures of the truffle fungi.

2. Storage of Infested Grains at −80° C.

Once a truffle fungus has been growing on PDA for several weeks, a group of 20-30 sterile (autoclaved) barley or rice seeds were placed on the agar surface over the growing fungal culture which allowed the seeds to become infested with the fungus. The seeds had been prepared by adding water at 1 volume seeds to 1 volume water and then autoclaved followed by cooling and re-autoclaving with the addition of 0.5 vol water to 1 vol of grain. Two cycles of autoclaving were needed to destroy the spore forming bacteria commonly associated with them. The sterilized grains were incubated on the truffle fungus infested plate for two to three weeks and then placed in cryo-vials, appropriately labeled, at −80° C. for extended periods. The tested truffle fungi were readily recovered from this storage condition for a minimum of 1 year after placement at this storage temperature.

3. Storage of Infested Dried Grain at 22° C.

The infested seeds, above as outlined, instead of being placed at −80° C. were simply removed from the PDA plate and placed in an empty plastic Petri plate and allowed to dry at 22° C. The plates were then wrapped with parafilm and stored at 22° C.

Intermittently, seeds were removed and placed on regular PDA to check for fungal viability. Each of the tested truffle fungi could withstand drying and storage at room temperature for at least one year or longer.

Other observations on the storage and durability of the truffle fungi at various temperatures revealed the following:

- a. Infested seeds can also be stored at −18 to −20° C. and the fungi remain viable for extended periods. They also remain viable if removed from storage, thawed and refrozen.
- b. Infested seeds, when placed at −80° C. then removed and thawed and refrozen, also remain viable. This is not a common observation for most fungi as they expire if frozen—thawed—and refrozen.
- c. The fungi can stand heat exposures of many minutes of up to 35 to 50° C.
- d. The truffle fungi generally expires at 65 to 70° C. with a two-hour exposure.

Ultimately, each of the truffle fungi were grown on sterile barley seeds for several weeks and then these colonized seeds were transferred to cryo-vials and stored at −80° C. and they all can be successfully stored under these conditions for extended periods. They are all successfully stored and preserved in the Montana State University culture collection and in the collection of the Black Boar Truffle Co.

Example 3. Use of Isolated Truffle Fungi Species

Pure cultures of many of the truffle fungi described above have been developed available. Each of these can now be grown on artificial and natural media, as well as a wide range of natural products such as grains, nuts, and fruits which will make available an untold number of possible novel products each with a different set or combination of flavors. The truffle fungus will potentially convert the natural products in the grain or fruit into other compounds that have interesting and useful flavored substances lending novelty to the fermentation process and new product development.

Furthermore, the novel truffle fungus isolation procedure disclosed above will readily allow for the recovery of numerous local strains of the fungus which may prove useful in finding stand alone and unique natural foods. In this case novel flavors can be created by growing the local truffle strains of the fungus on grains, nuts, powders, floral parts or mixtures of such natural plant products.

The technique for culturing these fungi on seeds and grains is mostly done by solid state fermentation as follows:

- 1. Use 1 liter volume of the product such as rye, rice or barley seeds water
- 2. Add water at 0.6 up to 3.0 liter (depending upon the seeds being used)
- 3. Then add 5 g glucose, 1 g peptone and 2 g of yeast extract stir liberally.

Various sized Erlenmeyer or other specially designed glass flasks may be used to carry out the fermentation process. The truffle fungi prefer not to grow in a submerged state, therefore the amount of water present in the final mixture is critical to fungal growth and development. However, in most cases for solid-state mass production, the mixture is placed in a plastic bag having a 1.5- to 2-inch-wide portal that is plugged with a foam cylinder and covered with a sheet of aluminum foil after inoculation. Autoclaving is done for 30-40 min. in order to achieve complete sterilization of the contents. Upon cooling the bag is then inoculated with the spores and mycelium of one of the truffle fungi by placing them though the opening port in the bag. One way to inoculate the bag with spores is, for example, by inoculating with 10-20 Tuber spp. infested barely seeds that had been incubated on a PDA plate for several weeks. The spores and mycelium then grow throughout the contents of the plastic bag. The bag is incubated under still conditions in the dark at 19-20° C. for 4-6 weeks with periodic mixing of the contents by handling. A temperature lower than that of normal room temperature is preferred i.e., 19-20° C.

The contents of the bag may be treated differently, depending upon what is being fermented. Initially, various grains/seeds including wheat, rice, rye, lentils and barley were fermented utilizing the first truffle fungus that was successfully isolated—Tuber melanosporum. After fermentation the seeds were removed and placed on a flat metal pan and heated at 60° C. in order to effectively dry the product. The seeds are then ground to a fine powder and thus made ready as a product for testing. The dark powder rye truffle product (FIG. 12) is now widely sold as an additive to salt (truffle salt) and olive oil (truffle oil) and finished bagged products such as truffle potato chips (Table 4). The development of other powders resulting from the fermentation of this truffle fungus on various other seeds has been done and the products have been tested and are being made ready for the marketing process (Table 4). This includes the novel black truffle products made with lentils, brown rice, wheat and barley as substrates for the fungus. Finally, soybeans were used as a substrate for the black truffle fungus and both the liquid (filtrate from the fermentation process) and the dried powder produced a basic classic truffle flavored product. The liquid has the potential of being labeled as truffle soy sauce after the famous Japanese soy sauce but with the added truffle flavoring notes (Table 4). The various powders made from these grain fermentations may be used for flavorings for hot drinks, salts, oils, vinegars, as well as for seasonings for meats, baked goods, eggs, and soups. Appropriate testing has been done to demonstrate the practical uses of each of these plant sourced fermentation powders.

TABLE 4

Fermentation of the black truffle (T. melanosporum) on various substrates and the

products and uses derived thereof. It is to be noted that each of these products has its own distinct

odor and flavor. A multitude of uses are currently and potentially possible.

Plant source

Public acceptance

or nutrient source
Final product
Uses of product
And sales

Rye
Dark brown powder
Truffle salt, truffle olive
Yes-worldwide

oil, potato chips,
marketing and sales

general flavoring
for uses indicated

Barley
Light brown powder
Potential for breads,
In development

biscuit mixes, general

flavoring -maybe pizzas

coffee and tea flavoring

Wheat organic (Kamut)
Light brown powder
A flavoring substance
In development

with a mild truffle taste

For eggs, meats, drinks

Lentil
Brown powder
Used to flavor soups,
A novel product with

drinks, salts and oils
multiple uses.

Brown rice
Brown powder
Food flavoring as per
Tested for many uses

the rye product above
and accepted as a

and coffee flavoring
potential product as per

additive. Maybe a better
the rye product above

substrate for the fungus

than the rye

Soybeans
Liquid from
Mild but distinctive
In development and

fermentation/brown
truffle smell and taste
may have potential as

powder from dried
Truffle flavoring agents
products but will

fermentation product

require research

Besides grains there are a plethora of other seeds, and nuts that may serve as potential fermentation sources for the truffle fungi. To this end, a representative list of commonly available natural products was tested for their abilities to support the growth of the various truffle fungi and make novel useable and desirable food products. In the case of nuts and seeds the fermentation was carried out as described above in the grain testing experiments. The initial tests were done with pecans incubated with the black truffle fungus; the final product was a viscous liquid mash like product which could be utilized in a multitude of ways. The white truffle fungus was also fermented in this manner. The final fermentation product could also be dried and ground to a powder for use (Table 5). However, the viscous liquid product, taken directly from fermentation, could ideally be used as a dressing for buns, biscuits, toast, waffles or crackers and a plethora of other foods especially when mixed with honey or maple syrup for a sweetened version of the truffle/pecan mixture.

As an example of the utility of the black truffle-pecan mash is the production of a mixture that is tasty and has a multitude of uses. The product is made by making a 50:50 v/v mixture with honey which can be used as a novel biscuit, toast or waffle spread. Modifications of the mixture can be made by varying the ratio of honey to the pecan/truffle fermentation product down to the 5% level still with acceptable taste results. A taste test of the 50/50 mixture was given to a panel of local adults and their responses showed overwhelmingly that they thought the product was tasty and novel (Table 6). Two respondents did not like the truffle smell and taste, and this is a perfect match to the general population i.e. approximately 20% who feel likewise with truffle products. A similar mixture was made with English walnuts yielding and entirely different tasting dried product with both the black and white truffle fermentation products. Different ratios of the honey to the nut/truffle product have also been made and tested with comparable results. Other possibilities include hazelnuts, peanuts, almonds, brazil nuts, cashews, pistachios, macademia, chestnut, and cacao. These results provided encouragement to proceed with other nuts and seeds as per Table 5.

As outlined above many other nuts and seeds were fermented using the exact fermentation formula and conditions as described for pecans and walnuts as shown in Table 5. As an example, coffee beans were fermented for 6 weeks on sterile coffee beans and the sugar/peptone mixture, and the final dried product (as above) was ground and mixed at different levels with standard coffee bean powder and made into a delicious drink. The final product was made by mixing either 10% or 20% of the truffle coffee bean powder with 80 to 90% of regular coffee beans to make the brew for the best truffle/coffee taste. Also, the addition of cream to the coffee bean mixture resulted in a wonderful tasting truffle/coffee/latte (Table 5). The same process has been applied in making a truffle cocoa mix using one or more of the truffle powders or mash products to be mixed/added to standard cocoa powder or powder mixture to produce the drink (Table 5). In each of the nut/bean cases novel products can be made as candies mixed with chocolate, white chocolate or other sugary substances to yield novel tasting products each of which can be labeled with the truffle species used to make the product. Such is the case with the hazelnut whose taste was distinctly unique from the other nut products (Table 5).

In each of these examples done with the black truffle, the process can be substituted with any of the other truffle fungi that have been isolated by the methods described and subsequently applied to the fermentation schedules as outlined for the black truffle (Table 4). Basically, totally new products can be made because the flavoring is different with each of the truffles. Virtually all the major truffle species have been isolated in this manner and testing has shown that they do grow on natural products such as seeds and beans as per the T. melanosporum (black truffle). Furthermore, it is extremely likely that individual truffle isolates will have important subtle flavoring properties that are unique to them which makes the isolation and acquisition of individual truffle strains even more important.

TABLE 5

Plant source
T. melanosporum
T. borchii
T. uncinatum
T. magnatum
T. aestivum

White rice
Dark brown powder
A nice mild
A potential mild
A nice sweetened
No product

long grain
for salt and oil
flavored product
flavoring product
product with

flavorings
as a seasoning

A special nutty

taste-potential

flavoring

Brown rice
Dark brown powder

A novel flavored
A very nice
—

Long grain
for truffle flavorings

sweet product for
intense

a multitude of
fruity/truffle

flavorings
flavor#

Pecan mash
Mixed with honey or

Mix with honey

or
maple syrup -novel

or maple syrup -

Pecan powder
food products*

nutty/mild truffle

taste at 10%*

Walnut
Mixed with honey

Mix with honey

English-mash
for a unique nut

or maple syrup -

or powder
product for toppings,

nutty/mild truffle

spreads

taste at 10%

Hazelnut
Mixed with honey

mash+
or maple syrup for

toppings

Pine nut
Dried product with

novel tangy-peppery

taste

Mustard
A taste better than

Very unique mild

mustard with nice

truffle taste- no

truffle flavored

bitterness-a novel

product-tangy

mustard product-

Cacao roasted
Dried powder tastes

like chocolate but no

bitterness

Coffee
Mixed up to 10%

beans+
with regular coffee,

yields truffle/coffee

Sunflower+
For flavorings has

For tapenades,

the standard truffle

-umami taste

odor and taste

Great Seasoning

Sesame
A remarkably

novel spicy tasting

powder for

seasonings

Soybean
See table 3

Fermentation

Powder and/

liquid, as well

or liquid

as powder-

fermentation

umami flavor

products

*See Table for subject evaluation ratings for this product as an example of how evaluations of these novel products were performed (Table 6). This fungus made useable large truffle like structures in this culture.

+These are very promising and very surprising novel products.

A totally unexpected result was obtained when the fermentation product of the white truffle fungus had been grown on sunflower seeds (Table 5). The dried fermentation product yielded a unique savory-umami tasting/smelling product that represents a total all around seasoning for roasts, and steaks and seafoods. It was evaluated by a well-trained chef and its use for tapenades was also suggested (Table 5). Interestingly, the pine nut product yielded a very spicey almost peppery tasting product that could be used in salad dressings and other flavoring products (Table 5). Likewise, the fermentation filtrate (white truffle) as well as the powder from the soybean test yielded nice umami-like products (Table 5).

Both the white and brown long grain rice products with the black truffle fungus yielded a black powder product for use as a general flavoring agent. The rice as a substrate has the advantages of being relatively uncontaminated and easier and quicker for the truffle fungi to ferment based on the ease and shorter times for the fungi to grow and develop on these substrates. Both the burgundy and the whitish truffle fungi did yield potential mild flavoring products on white long grained white rice, but no products could be obtained from the summer truffle (Table 5). Finally, mustard sauce made from the white and black truffle fermentation products yielded totally novel tasting mustards with white and black truffle tasting overtones with totally unique very distinctive appetizing flavors (Table 5).

TABLE 6

Taste panel evaluation of the black truffle pecan honey syrup product mixed 10-

20% by weight with honey.*

Would you buy it

Person's
Novelty of product
if available

designation
1-10 low to high
reasonably
Added comments

1
7
Yes
Chocolate taste

2
7
Yes
Different nice taste

3
8
Yes
Hint of chocolate

4
7.5
Yes
Chocolate taste

5
6.5
Yes
Toffee -like

6
8
Yes
Chocolate- like

7
8
Yes
Novel taste -nice

8
8
Yes
Very good taste

9
8
Yes
Excellent taste

10
7
Yes
Novel taste-great!

11
0
No
Bad smell

12
10
Yes
Great, wonderful

13
10
Yes
Perfect treat taste

14
8
Yes
Novel, interesting

15
8
Yes
Very nice taste

16
0
No
Intolerable taste

17
7
Yes
Nice taste- surprise

All subjects were adults living in Bozeman and many were professionals or student volunteers. They had many suggestion for the use of the product i.e. for toast, waffles, and a spread for fancy crackers. The two outliers reflected the normal human average of about 20% of the population who do not like the odor or taste of truffles or truffle products.

Besides growing the truffle fungi on seeds (grains) and nuts, a wide variety of berries and fruits were fermented into juices/drinks with novel tasting results (Table 7). In each case the following set up was done to carry out the fermentation and evaluation processes:

- 1. Use 150 g of fruit or berry product that was liberally smashed.
- 2. Added 0.25 g of peptone
- 3. Added 100 ml of water

Incubated for 2 weeks at 19-20° C. and then the contents were filtered through 4 layers of coffee filter paper to yield mostly a clear product. Taste testing was done using at least a minimum of three subjects doing an evaluation ranking of 1-10 based on flavor, sweetness, uniqueness, desirability, and overall potential as a novel drink perhaps for use as an aperitif or digestif. The data were subjected to averaging and standard deviation of the mean (Table 7). It is to be noted that with the Thompson seedless grapes each of the truffle fungi yielded a better tasting product than the liquid product having not supported fungal growth (control) (Table 7). The same was true with all products having a grape additive including red seedless or black seedless alone, and/or blackberry alone or with any of the grape additives (Table 7). The dried cherry drink with either the black or the white truffle fungi was also superior. However, generally the golden kiwi did not yield any product with outstanding potential (Table 7). Interestingly, the yellow mango drinks with market potential were the black, whitish and summer truffle fungi (Table 7). Likewise, the red raspberries and huckleberries also yielded excellent drink products especially with the black truffle fungus, but the burgundy truffle gave excellent results with the Thompson seedless grapes, the dried cherries as well as the huckleberries (Table 7).

Table 7—Juice evaluation of the truffle fungal fermentation of various berries/fruits after incubation for 2 weeks at 22 C and then harvested by filtering 4 layers of a coffee filter. Evaluation was done by at least 5 people who rated the juice by flavor, sweetness, uniqueness, desirability and overall potential as a novel drink. The scale was 1 lowest and 10 highest.

Truffle Fungus Used in Fermentation

Plant Source
T. melanosporum
T. borchii
T. aestivum
T. uncinatum
T. magnatum
none

Thompson
9.5 ± 0.4
4.5 ± 0.4
4.0 ± 0
7.8 ± 1.2
7.3 ± .7
1.5 ± 0

Seedless grapes

Red
9.2 ± 0.4
—
—
—
5.4 ± 1.0
1.5 ± 0

Seedless grapes

Blackberry with
8.0 ± 0.7
—
—
—
—