The present invention relates to novel uses of HIV proteins in medicine and vaccine compositions containing such HIV proteins. In particular, the invention relates to the use of HIV Tat and HIV gp120 proteins in combination. Furthermore, the invention relates to the use of HIV Nef and HIV gp120 proteins in combination. The invention also relates to DNA encoding HIV Tat and/or Nef (hereinafter Tat DNA and/or Nef DNA) and DNA encoding HIV gp120 (hereinafter gp120 DNA) and vectors comprising such DNAs. The invention relates in particular to administering the proteins and/or DNAs in a prime-boost schedule via a particle bombardment approach.

HIV-1 is the primary cause of the acquired immune deficiency syndrome (AIDS) which is regarded as one of the world's major health problems. Although extensive research throughout the world has been conducted to produce a vaccine, such efforts thus far have not been successful.

The HIV envelope glycoprotein gp120 is the viral protein that is used for attachment to the host cell. This attachment is mediated by the binding to two surface molecules of helper T cells and macrophages, known as CD4 and one of the two chemokine receptors CCR-4 or CXCR-5. The gp120 protein is first expressed as a larger precursor molecule (gp160), which is then cleaved post-translationally to yield gp120 and gp41. The gp120 protein is retained on the surface of the virion by linkage to the gp41 molecule, which is inserted into the viral membrane.

The gp120 protein is the principal target of neutralizing antibodies, but unfortunately the most immunogenic regions of the proteins (V3 loop) are also the most variable parts of the protein. Therefore, the use of gp120 (or its precursor gp160) as a vaccine antigen to elicit neutralizing antibodies is thought to be of limited use for a broadly protective vaccine. The gp120 protein does also contain epitopes that are recognized by cytotoxic T lymphocytes (CTL). These effector cells are able to eliminate virus-infected cells, and therefore constitute a second major antiviral immune mechanism. In contrast to the target regions of neutralizing antibodies some CTL epitopes appear to be relatively conserved among different HIV strains. For this reason gp120 and gp 160 are considered to be useful antigenic components in vaccines that aim at eliciting cell-mediated immune responses (particularly CTL).

Non-envelope proteins of HIV-1 have been described and include for example internal structural proteins such as the products of the gag and pol genes and, other non-structural proteins such as Rev, Nef, Vif and Tat (Greene et al., New England J. Med, 324, 5, 308 et seq (1991) and Bryant et al. (Ed. Pizzo), Pediatr. Infect. Dis. J., 11, 5, 390 et seq (1992).

HIV Tat and Nef proteins are early proteins, that is, they are expressed early in infection and in the absence of structural protein.

In a conference presentation (C. David Pauza, Immunization with Tat toxoid attenuates SHIV89.6PD infection in rhesus macaques, 12^thCent Gardes meeting, Marnes-La-Coquette, Oct. 26, 1999), experiments were described in which rhesus macaques were immunised with Tat toxoid alone or in combination with an envelope glycoprotein gp160 vaccine combination (one dose recombinant vaccinia virus and one dose recombinant protein). However, the results observed showed that the presence of the envelope glycoprotein gave no advantage over experiments performed with Tat alone.

However, we have found that a Tat- and/or Nef-containing immunogen (especially a Nef-Tat fusion protein) acts synergistically with gp120 in protecting rhesus monkeys from a pathogenic challenge with chimeric human-simian immunodeficiency virus (SHIV). To date the SHIV infection of rhesus macaques is considered to be the most relevant animal model for human AIDS. Therefore, we have used this preclinical model to evaluate the protective efficacy of vaccines containing a gp120 antigen and a Nef- and Tat-containing antigen either alone or in combination. Analysis of two markers of viral infection and pathogenicity, the percentage of CD4-positive cells in the peripheral blood and the concentration of free SHIV RNA genomes in the plasma of the monkeys, indicated that the two antigens acted in synergy. Immunization with either gp120 or NefTat+SIV Nef alone did not result in any difference compared to immunization with an adjuvant alone. In contrast, the administration of the combination of gp120 and NefTat+SIV Nef, antigens resulted in a marked improvement of the two above-mentioned parameters in all animals of those particular experimental group.

As described above, the Neffat protein, the SIV Nef protein and gp120 protein together give an enhanced response over that which is observed when either NefTat+SIV Nef, or gp120 are used alone. This enhanced response, or synergy can be seen in a decrease in viral load as a result of vaccination with these combined proteins. Alternatively, or additionally the enhanced response manifests itself by a maintenance of CD4+ levels over those levels found in the absence of vaccination with HIV NefTat, SIV Nef and HIV gp120. The synergistic effect is attributed to the combination of gp120 and Tat, or gp120 and Nef, or gp120 and both Nef and Tat.

It has been found that not only the Nef, Tat or NefTat proteins are advantageously combined or administered with the gp 120 protein. The same advantages are seen when DNA encoding Nef, Tat or NefTat is administered with gp 120 (protein or corresponding DNA).

It has been found that the proteins above, or DNA encoding the proteins, may advantageously be administered via a prime-boost strategy. In one aspect the present invention relates to such administration via a bombardment approach. Accordingly the invention provides the use of

a) an HIV Tat protein or polynucleotide; or

b) an HIV Nef protein or polynucleotide; or

c) an HIV Tat protein or polynucleotide linked to an HIV Nef protein or polynucleotide;

and an HIV gp120 protein or polynucleotide in the manufacture of a vaccine suitable for a prime-boost delivery for the prophylactic or therapeutic imrnmunisation of humans against HIV, wherein the protein or polynucleotide is delivered via a bombardment approach.

Numerous methods of carrying out a particle bombardment approach are known. See for example WO 91/07487. In one illustrative example, gas-driven particle acceleration can be achieved with devices such as those manufactured by Powdeiject Pharmaceuticals PLC (Oxford, UK) and Powderject Vaccines Inc. (Madison, Wis.), some examples of which are described in U.S. Pat. Nos. 5,846,796; 6,010,478; 5,865,796; 5,584,807; and EP Patent No. 0500 799. This offers a needle-free delivery approach wherein a dry powder formulation of microscopic particles, coated with a substance such as polynucleotide, is accelerated to high speed within a helium gas jet generated by a hand held device, propelling the particles into a target tissue of interest, typically the skin. The particles are preferably gold beads of a 0.4-4.0 Î¼M, more preferably 0.6-2.0 Î¼m diameter and the polynucleotide, preferably DNA is coated onto these and then encased in a cartridge for placing into the â€œgene gunâ€ .

The addition of other HIV proteins or DNA encoding them may further enhance the synergistic effect, which was observed between gp120 and Tat and/or Nef. These other proteins may also act synergistically with individual components of the gp120, Tat and/or Nef-containing vaccine, not requiring the presence of the full original antigen combination. The additional proteins may be regulatory proteins of HIV such as Rev, Vif Vpu, and Vpr. They may also be structural proteins derived from the HIV gag or pol genes.

The HIV gag gene encodes a precursor protein p55, which can assemble spontaneously into immature virus-like particles (VLPs). The precursor is then proteolytically cleaved into the major structural proteins p24 (capsid) and p18 (matrix), and into several smaller proteins. Both the precursor protein p55 and its major derivatives p24 and p18 may be considered as appropriate vaccine antigens which may further enhance the synergistic effect observed between gp120 and Tat and/or Nef The precursor p55 and the capsid protein p24 may be used as VLPs or as monomeric proteins.

The HIV Tat protein for use in the present invention may, optionally, be linked to an HIV Nef protein, for example as a fusion protein.

The HIV Tat protein, the HIV Nef protein or the NefTat fusion protein for use in the present invention may have a C terminal Histidine tail which preferably comprises between 5-10 Histidine residues. The presence of an histidine (or â€˜Hisâ€™) tail aids purification.

In a preferred embodiment the proteins are expressed with a Histidine tail comprising between 5 to 10 and preferably six Histidine residues. These are advantageous in aiding purification. Separate expression, in yeast (Saccharomyces cerevisiae), of Nef (Macreadie I. G. et al., 1993, Yeast 9 (6) 565-573) and Tat (Braddock M et al., 1989, Cell 58 (2) 269-79) has been reported. Nef protein and the Gag proteins p55 and pl8 are myristoylated. The expression of Nef and Tat separately in a Pichia expression system (Nef-His and Tat-His constructs), and the expression of a fusion construct Nef-Tat-His have been described previously in WO99/16884.

The DNA and amino acid sequences of representative Nef-His (Seq. ID. No.s 8 and 9), Tat-His (Seq. ID. No.s 10 and 11) and of Nef-Tat-His fusion proteins (Seq. ID. No.s 12 and 13) are set forth in FIG. 1.

The HIV proteins may be used in their native conformation, or more preferably, may be modified for vaccine use. These modifications may either be required for technical reasons relating to the method of purification, or they may be used to biologically inactivate one or several functional properties of the Tat or Nef protein. Thus the invention encompasses the use of derivatives of HIV proteins or polynucleotides, particularly DNAs, which may be, for example, mutated. The term â€˜mutatedâ€™ is used herein to mean a DNA or protein molecule which has undergone deletion, addition or substitution of one or more nucleotides or amino acids using well known techniques for site directed mutagenesis or any other conventional method.

For example, a mutant Tat protein may be mutated so that it is biologically inactive whilst still maintaining its immunogenic epitopes. One possible mutated tat gene, constructed by D.Clements (Tulane University), (originating from BH10 molecular clone) bears mutations in the active site region (Lys41â†’Ala)and in RGD motif (Arg78â†’Lys and Asp80â†’Glu) (Virology 235: 48-64, 1997).

A mutated Tat is illustrated in FIG. 1 (Seq. ID. No.s 22 and 23) as is a Nef-Tat Mutant-His (Seq. ID. No.s 24 and 25).

The HIV Tat or Nef proteins for use in the present invention may be modified by chemical methods during the purification process to render the proteins stable and monomeric. One method to prevent oxidative aggregation of a protein such as Tat or Nef is the use of chemical modifications of the protein's thiol groups. In a first step the disulphide bridges are reduced by treatment with a reducing agent such as DTT, beta-mercaptoethanol, or gluthatione. In a second step the resulting thiols are blocked by reaction with an alkylating agent (for example, the protein can be caused to react with iodoacetamide). Such chemical modification does not modify functional properties of Tat or Nef as assessed by cell binding assays and inhibition of lymphoproliferation of human peripheral blood mononuclear cells.

It will be understood that the invention also emcompasses the use of fragments of the full length proteins provided that the fragments comprise at least one immunogenic epitope.

The HIV Tat protein and HIV gp120 proteins can be purified by the methods outlined in the attached examples.

An immunoprotective or immunotherapeutic quantity of the Tat and/or Nef or Neff at and gp120 components (protein or DNA) for use in the invention may be prepared by conventional techniques.

Vaccine preparation is generally described in New Trends and Developments in Vaccines, edited by Voller et al., University Park Press, Baltimore, Md., U.S.A. 1978. Encapsulation within liposomes is described, for example, by Fullerton, U.S. Pat. No. 4,235,877. Conjugation of proteins to macromolecules is disclosed, for example, by Likhite, U.S. Pat. No. 4,372,945 and by Armor et al., U.S. Pat. No. 4,474,757.

The amount of protein in a vaccine dose is selected as an amount which induces an immunoprotective response without significant, adverse side effects in typical vaccinees. Such amount will vary depending upon which specific immunogen is employed. Generally, it is expected that each dose will comprise 1-1000 Î¼g of each protein, preferably 2-200 Î¼g, most preferably 4-40 Î¼g of Tat or Nef or NefTat and preferably 1-150 Î¼g, most preferably 2-25 Î¼g of gp120. An optimal amount for a particular vaccine can be ascertained by standard studies involving observation of antibody titres and other responses in subjects. One particular example of a vaccine dose will comprise 20 Î¼g of NefTat and 5 or 20 Î¼g of gp120. Following an initial vaccination, subjects may receive a boost in about 4 weeks, and a subsequent second booster immunisation.

The proteins of the present invention are preferably adjuvanted in a vaccine formulation of the invention. The polynucleotides used in the present invention are optionally adjuvanted, and may be delivered in a formulation with an adjuvant or separately from the adjuvant, either simultaneously or sequentially. Adjuvants are described in general in Vaccine Designâ€”the Subunit and Adjuvant Approach, edited by Powell and Newman, Plenum Press, New York, 1995.

Suitable adjuvants include an aluminium salt such as aluminium hydroxide gel (alum) or aluminium phosphate, but may also be a salt of calcium, iron or zinc, or may be an insoluble suspension of acylated tyrosine, or acylated sugars, cationically or anionically derivatised polysaccharides, or polyphosphazenes.

In the formulation of vaccines for use in the invention it is preferred that the adjuvant composition induces a preferential Th1 response. However it will be understood that other responses, including other humoral responses, are not excluded.

An immune response is generated to an antigen through the interaction of the antigen with the cells of the immune system. The resultant immune response may be broadly distinguished into two extreme catagories, being humoral or cell mediated immune responses (traditionally characterised by antibody and cellular effector mechanisms of protection respectively). These categories of response have been termed Th1-type responses (cell-mediated response), and T2-type immune responses (humoral response).

Extreme Th1-type immune responses may be characterised by the generation of antigen specific, haplotype restricted cytotoxic T lymphocytes, and natural killer cell responses. In mice Th1-type responses are often characterised by the generation of antibodies of the IgG2a subtype, whilst in the human these correspond to IgG1 type antibodies. Th2-type immune responses are characterised by the generation of a broad range of immunoglobulin isotypes including in mice IgG1, IgA, and IgM.

It can be considered that the driving force behind the development of these two types of immune responses are cytokines, a number of identified protein messengers which serve to help the cells of the immune system and steer the eventual immune response to either a Th1 or Th2 response. Thus high levels of Th1-type cytokines tend to favour the induction of cell mediated immune responses to the given antigen, whilst high levels of Th2-type cytokines tend to favour the induction of humoral immune responses to the antigen.

It is important to remember that the distinction of Th1 and Th2-type immune responses is not absolute. In reality an individual will support an immune response which is described as being predominantly Th1 or predominantly Th2. However, it is often convenient to consider the families of cytokines in terms of that described in murine CD4 +ve T cell clones by Mosmann and Coffman (Mosmann, T. R. and Coffinan, R. L. (1989) TH1 and TH2 cells: different patterns of lynphokine secretion lead to different functional properties. Annual Review of Immunology, 7, p145-173). Traditionally, Th1-type responses are associated with the production of the INF-Î³ and IL-2 cytokines by T-lymphocytes. Other cytokines often directly associated with the induction of Th1-type immune responses are not produced by T-cells, such as IL-12. In contrast, Th2- type responses are associated with the secretion of IL-4, IL-5, IL-6, IL-10 and tumour necrosis factor-Î² (TNF-Î²).

It is known that certain vaccine adjuvants are particularly suited to the stimulation of either Th1 or Th2â€”type cytokine responses. Traditionally the best indicators of the Th1:Th2 balance of the immune response after a vaccination or infection includes direct measurement of the production of Th1 or Th2 cytokines by T lymphocytes in vitro after restimulation with antigen, and/or the measurement of the IgG1:IgG2a ratio of antigen specific antibody responses.

Thus, a Th1-type adjuvant is one which stimulates isolated T-cell populations to produce high levels of Th1-type cytokines when re-stimulated with antigen in vitro, and induces antigen specific immunoglobulin responses associated with Th1-type isotype.

Preferred Th1-type immunostimulants which may be formulated to produce adjuvants suitable for use in the present invention include and are not restricted to the following.

Monophosphoryl lipid A, in particular 3-de-O-acylated monophosphoryl lipid A (3D-MPL), is a preferred Th1-type immunostimulant for use in the invention. 3D-MPL is a well known adjuvant manufactured by Ribi Immunochem, Montana. Chemically it is often supplied as a mixture of 3-de-O-acylated monophosphoryl lipid A with either 4, 5, or 6 acylated chains. It can be purified and prepared by the methods taught in GB 2122204B, which reference also discloses the preparation of diphosphoryl lipid A, and 3-O-deacylated variants thereof Other purified and synthetic lipopolysaccharides have been described (U.S. Pat. No. 6,005,099 and EP 0 729 473 B1; Hilgers et al., 1986, Int.Arch.Allergy.Immunol., 79(4):392-6; Hilgers et al., 1987, Immunology, 60(1):141-6; and EP 0 549 074 B1l). A preferred form of 3D-MPL is in the form of a particulate formulation having a small particle size less than 0.2 Î¼m in diameter, and its method of manufacture is disclosed in EP 0 689 454.

Saponins are also preferred Th1 immunostimulants in accordance with the invention. Saponins are well known adjuvants and are taught in: Lacaille-Dubois, M and Wagner H. (1996. A review of the biological and pharmacological activities of saponins. Phytomedicine vol 2 pp 363-386). For example, Quil A (derived from the bark of the

South American tree Quillaja Saponaria Molina), and fractions thereof, are described in U.S. Pat. No. 5,057,540 and â€œSaponins as vaccine adjuvantsâ€ , Kensil, C. R., Crit Rev Ther Drug Carrier Syst, 1996, 12 (1-2):1-55; and EP 0 362 279 B1. The haemolytic saponins QS21 and QS17 (HPLC purified fractions of Quil A) have been described as potent systemic adjuvants, and the method of their production is disclosed in U.S. Pat. No. 5,057,540 and EP 0 362 279 B1. Also described in these references is the use of QS7 (a non-haemolytic fraction of Quil-A) which acts as a potent adjuvant for systemic vaccines. Use of QS21 is further described in Kensil et al. (1991. J. Immunology vol 146, 431-437). Combinations of QS21 and polysorbate or cyclodextrin are also known (WO 99/10008). Particulate adjuvant systems comprising fractions of QuiLA, such as QS21 and QS7 are described in WO 96/33739 and WO 96/11711.

Another preferred immunostimulant is an immunostimulatory oligonucleotide containing unmethylated CpG dinucleotides (â€œCpGâ€ ). CpG is an abbreviation for cytosine-guanosine dinucleotide motifs present in DNA. CpG is known in the art as being an adjuvant when administered by both systemic and mucosal routes (WO 96/02555, EP 468520, Davis et al, J.Immunol, 1998, 160(2):870-876; McCluskie and Davis, J.Immunol., 1998, 161(9):4463-6). Historically, it was observed that the DNA fraction of BCG could exert an anti-tumour effect. In further studies, synthetic oligonucleotides derived from BCG gene sequences were shown to be capable of inducing immunostimulatory effects (both in vitro and in vivo). The authors of these studies concluded that certain palindromic sequences, including a central CG motif, carried this activity. The central role of the CG motif in immunostimulation was later elucidated in a publication by Krieg, Nature 374, p546 1995. Detailed analysis has shown that the CG motif has to be in a certain sequence context, and that such sequences are common in bacterial DNA but are rare in vertebrate DNA. The immunostimulatory sequence is often: Purine, Purine, C, G, pyrimidine, pyrimidine; wherein the CG motif is not methylated, but other unmethylated CpG sequences are known to be immunostimulatory and may be used in the present invention.

In certain combinations of the six nucleotides a palindromic sequence is present. Several of these motifs, either as repeats of one motif or a combination of different motifs, can be present in the same oligonucleotide. The presence of one or more of these immunostimulatory sequences containing oligonucleotides can activate various immune subsets, including natural killer cells (which produce interferon y and have cytolytic activity) and macrophages (Wooldrige et al Vol 89 (no. 8), 1977). Other unmethylated CpG containing sequences not having this consensus sequence have also now been shown to be immunomodulatory.

CpG when formulated into vaccines, is generally administered in free solution together with free antigen (WO 96/02555; McCluskie and Davis, supra) or covalently conjugated to an antigen (WO 98/16247), or formulated with a carrier such as aluminium hydroxide ((Hepatitis surface antigen) Davis et aL supra ; Brazolot-Millan et al., Proc.Natl.Acad.Sci., USA, 1998, 95(26), 15553-8).

Such immunostimulants as described above may be formulated together with carriers, such as for example liposomes, oil in water emulsions, and or metallic salts, including aluminium salts (such as aluminium hydroxide). For example, 3D-MPL may be formulated with aluminium hydroxide (EP 0 689 454) or oil in water emulsions (WO 95/17210); QS21 may be advantageously formulated with cholesterol containing liposomes (WO 96/33739), oil in water emulsions (WO 95/17210) or alum (WO 98/15287); CpG may be formulated with alum (Davis et aL supra ; Brazolot-Millan supra) or with other cationic carriers.

Combinations of immunostimulants are also preferred, in particular a combination of a monophosphoryl lipid A and a saponin derivative (WO 94/00153; WO 95/17210; WO 96/33739; WO 98/56414; WO 99/12565; WO 99/11241), more particularly the combination of QS21 and 3D-MPL as disclosed in WO 94/00153. Alternatively, a combination of CpG plus a saponin such as QS21 also forms a potent adjuvant for use in the present invention.

Thus, suitable adjuvant systems include, for example, a combination of monophosphoryl lipid A, preferably 3D-MPL, together with an aluminium salt. An enhanced system involves the combination of a monophosphoryl lipid A and a saponin derivative particularly the combination of QS21 and 3D-MPL as disclosed in WO 94/00153, or a less reactogenic composition where the QS21 is quenched in cholesterol containing liposomes (DQ) as disclosed in WO 96/33739.

A particularly potent adjuvant formulation involving QS21, 3D-MPL & tocopherol in an oil in water emulsion is described in WO 95/17210 and is another preferred formulation for use in the invention.

Another preferred formulation comprises a CpG oligonucleotide alone or together with an aluminium salt.

Particularly preferred adjuvant and/or carrier combinations are as follows:

i) 3D-MPL+QS21 in DQ

ii) Alum+3D-MPL

iii) Alum+QS21 in DQ+3D-MPL

iv) Alum+CpG

v) 3D-MPL+QS21 in DQ+oil in water emulsion

vi) CpG

As already noted, the vaccine may contain polynucleotide, preferably DNA, encoding one or more of the Tat, Nef and gp120 polypeptides, such that the polypeptide is generated in situ.

The DNA constructs per se, especially those described herein, also form part of the invention.

The polynucleotide may be present within any of a variety of delivery systems known to those of ordinary skill in the art, including nucleic acid expression systems such as plasmid DNA, bacteria and viral expression systems. Numerous gene delivery techniques are well known in the art, such as those described by Rolland, Crit. Rev. Therap. Drug Carrier Systems 15:143-198, 1998 and references cited therein, incorporated herein by reference.

Plasmid based delivery of genes, particularly for immunisation or gene therapy purposes is known. For example, administration of naked DNA by injection into mouse muscle is outlined by Vical in International Patent Application W090/11092.

Johnston et al WO 91/07487 describe methods of transferring a gene to vertebrate cells, by the use of microprojectiles that have been coated with a polynucleotide encoding a gene of interest, and accelerating the microparticles such that the microparticles can penetrate the target cell.

DNA vaccines usually consist of a bacterial plasmid vector into which is inserted a strong viral promoter, the gene of interest which encodes for an antigenic peptide and a polyadenylation/transcriptional termination sequences. The gene of interest may encode a full protein, a fusion protein comprising different antigens, or simply an antigenic peptide sequence relating to the pathogen, tumour or other agent which is intended to be protected against. Thus the plasmid may encode a fragment of a full protein, provided that the fragment comprises at least one immunogenic epitope of the full protein. The plasmid can be grown in bacteria, such as for example E. coli and then isolated and prepared in an appropriate medium, depending upon the intended route of administration, before being administered to the host. Following administration the plasmid is taken up by cells of the host where the encoded peptide is produced. The plasmid vector will preferably be made without an origin of replication which is functional in eukaryotic cells, in order to prevent plasmid replication in the mammalian host and integration within chromosomal DNA of the animal concerned. All of these features may apply singly or in combination to the present invention.

There are a number of advantages of DNA vaccination relative to traditional vaccination techniques. First, it is predicted that because the proteins which are encoded by the DNA sequence are synthesised in the host, the structure or conformation of the protein will be similar to the native protein associated with the disease state. It is also likely that DNA vaccination will offer protection against different strains of a virus, by generating a cytotoxic T lymphocyte response that recognises epitopes from conserved proteins. Furthermore, because the plasmids are taken up by the host cells where antigenic protein can be produced, a long-lasting immune response will be elicited. The technology also offers the possibility of combining diverse immunogens into a single preparation to facilitate simultaneous immunisation in relation to a number of disease states.

Helpful background information in relation to DNA vaccination is provided in Donnelly et al â€œDNA vaccinesâ€ Ann. Rev linmunol. 1997 15: 617-648, the disclosure of which is included herein in its entirety by way of reference.

In one preferred embodiment the DNA can be delivered via a particle bombardment approach e.g. a â€œgene gunâ€ approach as described hereinabove.

Appropriate nucleic acid expression systems contain the necessary DNA sequences for expression in the patient (such as a suitable promoter and terminating signal). When the expression system is a recombinant live microorganism, such as a virus or bacterium, the gene of interest can be inserted into the genome of a live recombinant virus or bacterium. Inoculation and in vivo infection with this live vector will lead to in vivo expression of the antigen and induction of imnune responses. Viruses and bacteria used for this purpose are for instance: poxviruses (e.g; vaccinia, fowlpox, canarypox, modified poxviruses e.g. Modified Virus Ankara (MVA)), alphaviruses (Sindbis virus, Semliki Forest Virus, Venezuelian Equine Encephalitis Virus), flaviviruses (yellow fever virus, Dengue virus, Japanese encephalitis virus), adenoviruses, adeno-associated virus, picomaviruses (poliovirus, rhinovirus), herpesviruses (varicella zoster virus, etc), Listeria, Salmonella, Shigella, Neisseria, BCG. These viruses and bacteria can be virulent, or attenuated in various ways in order to obtain live vaccines.

Thus, the Nef, Tat and gp120 components of a preferred vaccine according to the invention may be provided in the form of polynucleotides or recombinant DNA encoding the desired proteins. The polynucleotides employed in the invention may encode a full protein, a fusion protein comprising different antigens, or one or more antigenic peptide sequences. Thus the polynucleotides may encode a fragment of a full protein, provided that the fragment comprises at least one immunogenic epitope of the full protein.

At least one of the DNAs for Nef, Tat, Neff at or gp 120 may preferably be codon optimised as described, for example, in Andre S. Seed B. Eberle J. Schraut W. Bultmainn A. Haas J. (1998): Increased immune response elicited by DNA vaccination with a synthetic gp120 sequence with optimized codon usage, Journal of Virology. 72(2):1497-503. In one preferred aspect the DNA encoding gp120 is codon optimised.

Codon optimisation is used to optimise the polynucleotide sequences for expression in mammalian cells. That is the sequence is optimised to resemble the codon usage of genes in mammalian cells.

In one embodiment of the present invention the Nef, Tat, NefTat or gp120 polynucleotide sequence has a codon usage pattern which resembles that of highly expressed mammalian genes, particularly human genes. Preferably the polynucleotide sequence is a DNA sequence. Desirably the codon usage pattern of the polynucleotide sequence is typical of highly expressed human genes.

The DNA code has 4 letters (A, T, C and G) and uses these to spell three letter â€œcodonsâ€ which represent the amino acids the proteins encodes in an organism's genes. The linear sequence of codons along the DNA molecule is translated into the linear sequence of amino acids in the protein(s) encoded by those genes. The code is highly degenerate, with 61 codons coding for the 20 natural amino acids and 3 codons representing â€œstopâ€ signals. Thus, most amino acids are coded for by more than one codonâ€”in fact several are coded for by four or more different codons.

Where more than one codon is available to code for a given amino acid, it has been observed that the codon usage patterns of organisms are highly non-random. Different species show a different bias in their codon selection and, firthermore, utilisation of codons may be markedly different in a single species between genes which are expressed at high and low levels. This bias is different in viruses, plants, bacteria and mammalian cells, and some species show a stronger bias away from a random codon selection than others. For example, humans and other mammals are less strongly biased than certain bacteria or viruses. For these reasons, there is a significant probability that a mammalian gene expressed in E.coli or a viral gene expressed in mammalian cells will have an inappropriate distribution of codons for efficient expression. It is believed that the presence in a heterologous DNA sequence of clusters of codons which are rarely observed in the host in which expression is to occur, is predictive of low heterologous expression levels in that host.

In the polynucleotides of the present invention, the codon usage pattern is altered from that typical of human immunodeficiency viruses to more closely represent the codon bias of the target organism, e.g. a mammal, especially a human. The â€œcodon usage coefficientâ€ is a measure of how closely the codon pattern of a given polynucleotide sequence resembles that of a target species. Codon frequencies can be derived from literature sources for the highly expressed genes of many species (see e.g. Nakamura et.al. Nucleic Acids Research 1996, 24:214-215). The codon frequencies for each of the 61 codons (expressed as the number of occurrences occurrence per 1000 codons of the selected class of genes) are normalised for each of the twenty natural amino acids, so that the value for the most frequently used codon for each amino acid is set to 1 and the frequencies for the less common codons are scaled to lie between zero and 1. Thus each of the 61 codons is assigned a value of 1 or lower for the highly expressed genes of the target species. In order to calculate a codon usage coefficient for a specific polynucleotide, relative to the highly expressed genes of that species, the scaled value for each codon of the specific polynucleotide are noted and the geometric mean of all these values is taken (by dividing the sum of the natural logs of these values by the total number of codons and take the anti-log). The coefficient will have a value between zero and 1 and the higher the coefficient the more codons in the polynucleotide are frequently used codons. If a polynucleotide sequence has a codon usage coefficient of 1, all of the codons are â€œmost frequentâ€ codons for highly expressed genes of the target species.

According to the present invention, the codon usage pattern of the polynucleotide will preferably exclude rare codons representing less than 10% of the codon use for an amino acid in highly expressed genes of the target organism. In an alternative preferred embodiment, the polynucleotide will exclude codons with an RSCU value of less than 0.2 in highly expressed genes of the target organism. A relative synonymous codon usage (RSCU) value is the observed number of codons divided by the number expected if all codons for that amino acid were used equally frequently. A polynucleotide of the present invention will generally have a codon usage coefficient for highly expressed human genes of greater than 0.3, preferably greater than 0.4, most preferably greater than 0.5. Codon usage tables for human can also be found in Genebank.

In comparison, a highly expressed beta action gene has a RSCU of 0.747. The codon usage table for a homo sapiens is set out below:

Codon Usage Table:

Homo sapiens [gbpri]: 27143 CDS's (12816923 codons) StandardCodon Usage Table fields: [triplet] [frequency: per thousand] ([number]) UUU17.0 (217684)UCU14.8 (189419)UAU12.1 (155645)UGU10.0 (127719) UUC20.5 (262753)UCC17.5 (224470)UAC15.8 (202481)UGC12.3 (157257) UUAâ€ƒ7.3 (â€ƒ93924)UCA11.9 (152074)UAAâ€‚0.7 (â€ƒâ€ƒ9195)UGAâ€ƒ1.3 (â€ƒ16025) UUG12.5 (159611)UCGâ€‚4.5 (â€ƒ57572)UAGâ€‚0.5 (â€ƒâ€ƒ6789)UGG12.9 (165930) CUU12.8 (163707)CCU17.3 (222146)CAU10.5 (134186)CGUâ€ƒ4.6 (â€ƒ59454) CUC19.3 (247391)CCC20.0 (256235)CAC14.9 (190928)CGC10.8 (137865) CUAâ€ƒ7.0 (â€ƒ89078)CCA16.7 (214583)CAA12.0 (153590)CGAâ€ƒ6.3 (â€ƒ80709) CUG39.7 (509096)CCGâ€‚7.0 (â€ƒ89619)CAG34.5 (441727)CGG11.6 (148666) AUU15.8 (202844)ACU12.9 (165392)AAU17.0 (218508)AGU12.0 (154442) AUC21.6 (277066)ACC19.3 (247805)AAC19.8 (253475)AGC19.3 (247583) AUAâ€ƒ7.2 (â€ƒ92133)ACA14.9 (191518)AAA24.0 (308123)AGA11.5 (147264) AUG22.3 (285776)ACGâ€‚6.3 (â€ƒ80369)AAG32.6 (418141)AGG11.3 (145276) GUU10.9 (139611)GCU18.5 (236639)GAU22.4 (286742)GGU10.8 (138606) GUC14.6 (187333)GCC28.3 (362086)GAC26.1 (334158)GGC22.7 (290904) GUAâ€ƒ7.0 (â€ƒ89644)GCA15.9 (203310)GAA29.1 (373151)GGA16.4 (210643) GUG28.8 (369006)GCGâ€‚7.5 (â€ƒ96455)GAG40.2 (515485)GGG16.4 (209907) Coding GC 52.5 1% 1st letter GC 56.04% 2nd letter GC 42.3 5%3rd letter GC 59.13%.

According to a further aspect of the invention, an expression vector is provided which comprises and is capable of directing the expression of a Nef and/or Tat or NefTat, and a gp120 polynucleotide sequence according to the first aspect of the invention, in particular where the codon usage pattern of at least one of the Nef, Tat, NefTat or gp120 polynucleotide sequences, particularly the gp120 sequence, is typical of highly expressed mammalian genes, preferably highly expressed human genes. The vector is suitable for driving expression of heterologous DNA in mammalian cells, particularly human cells. In one embodiment, the expression vector is p7313 (see FIG. 22).

In a further aspect the invention provides a plurality of particles, preferably gold particles, coated with DNA comprising one or more vectors encoding gp120 and nef and/or tat or neftat. Preferably the particles are coated with a single vector which encodes gp120 and nef and tat, the latter most preferably in the form of a NefTat fusion protein. Most preferably one or more of the sequences are codon optimised for expression in human cells.

In a preferred aspect the DNA encoding the nef, tat and gp 120 is present on a single vector.

Preferably the vector comprises the nef, tat and gp 120 sequences inserted 3â€² to an enhanced HCMV IE1 promoter for efficient expression. This is preferably the HCMV immediate early promoter devoid of intron A, but including exon 1.

One suitable vector according to the invention is that denoted as p7313, further described below.

The vectors which comprise the nucleotide sequences described herein are administered in such amount as will be prophylactically or therapeutically effective. The quantity to be administered is generally in the range of one picogram to 1 milligram, preferably 1 picogram to 10 micrograms for particle-mediated delivery as described herein. The exact quantity may vary depending on the weight of the patient being immunised and the precise route of administration.

Immunisations according to the invention may be performed with a combination of protein and DNA-based formulations. Adjuvanted protein vaccines induce mainly antibodies and T helper immune responses, while delivery of DNA as a plasmid or a live vector induces strong cytotoxic T lymphocyte (CTL) responses. Thus, the combination of protein and DNA vaccination will provide for a wide variety of immune responses. This is particularly relevant in the context of HIV, since both neutralising antibodies and CTL are thought to be important for the immune defence against HIV.

The DNA may be delivered as plasmid DNA or in the form of a recombinant live vector, e.g. a poxvirus vector or any other suitable live vector such as those described herein. Protein antigens may be injected once or several times followed by one or more DNA administrations, or DNA may be used first for one or more administrations followed by one or more protein immunisations.

A particular example of prime-boost immunisation according to the invention involves priming with DNA in the form of a recombinant live vector such as a modified poxvirus vector, for example Modified Virus Ankara (MVA) or a derivative thereof e.g through passaging or genetic manipulation, or an alphavirus vecotr for example Venezuelian Equine Encephalitis Virus, followed by boosting with a protein, preferably an adjuvanted protein. Optionally the DNA is adjuvanted with a suitable DNA vaccine adjuvant known in the art.

The invention further provides a method of prophylactic or therapeutic immunisation which method comprises administering to a subject in need thereof a composition comprising

a) an HIV Tat protein or polynucleotide: or

b) an HIV Nef protein or polynucleotide; or

c) an HIV Tat protein or polynucleotide linked to an HIV Nef protein or polynucleotide; and an HIV gp120 protein or polynucleotide, in a prime-boost delivery wherein the protein or polynucleotide is delivered via a bombardment approach.

In a further aspect the invention provides a kit comprising at least two different vaccine compositions including a) a composition comprising a plurality of particles coated with DNA encoding gp120 and nef and/or tat or neftat as described herein and b) a composition comprising gp120 and nef and/or tat or neftat DNA or proteins as described herein wherein the DNA or proteins in b) are not coated onto particles.

The invention is illustrated in the accompanying examples and Figures:

EXAMPLES General

The Nef gene from the Bru/Lai isolate (Cell 40: 9-17, 1985) was selected for the constructs of these experiments since this gene is among those that are most closely related to the consensus Nef .

The starting material for the Bru/Lai Nef gene was a 1170 bp DNA fragment cloned on the mammalian expression vector pcDNA3 (pcDNA3/Nef).

The Tat gene originates from the BH10 molecular clone. This gene was received as an HTLV III cDNA clone named pCV1 and described in Science, 229, p69-73, 1985.

The expression of the Nef and Tat genes could be in Pichia or any other host.

EXAMPLE 1 Expression of HIV-1 nef and tat Sequences in Pichia Pastories

Nef protein, Tat protein and the fusion Nef -Tat were expressed in the methylotrophic yeast Pichia pastoris under the control of the inducible alcohol oxidase (AOX1) promoter.

To express these HIV-1 genes a modified version of the integrative vector PHIL-D2 (INVITROGEN) was used. This vector was modified in such a way that expression of heterologous protein starts immediately after the native ATG codon of the AOX1 gene and will produce recombinant protein with a tail of one glycine and six histidines residues . This PHIL-D2-MOD vector was constructed by cloning an oligonucleotide linker between the adjacent AsuII and EcoRI sites of PHIL-D2 vector (see FIG. 2 which includes Seq ID Nos: 26 and 27). In addition to the His tail, this linker carries NcoI, SpeI and XbaI restriction sites between which nef, tat and nef-tat fusion were inserted.

1.1 Construction of the Interactive Vectors pRIT14597

(encoding Nef-His protein), pRIT14598 (encoding Tat-His protein) and pRIT14599 (encoding fusion Nef-Tat-His).

The nefgene was amplified by PCR from the pcDNA3/Nef plasmid with primers 01 and 02.

â€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒNcoIPRIMER 01: 5â€² ATCGTCCATG.GGT.GGC.AAG.TGG.T 3â€²(Seq ID NO 1) â€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒSpeIPRIMER 02: 5â€² CGGCTACTAGTGCAGTTCTTGAA 3â€²(Seq ID NO 2)

The PCR fragment obtained and the integrative PHIL-D2-MOD vector were both restricted by NcoI and SpeI, purified on agarose gel and ligated to create the integrative plasmid pRIT14597 (see FIG. 2).

The tat gene was amplified by PCR from a derivative of the pCV1 plasmid with primers 05 and 04:

â€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒSpelPRIMER 04: 5â€² CGGCTACTAGTTTCCTTCGGGCCT 3â€²(Seq ID NO 4) â€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒNcoIPRIMER 05: 5â€² ATCGTCCATGGAGCCAGTAGATC 3â€²(Seq ID NO 5)

An NcoI restriction site was introduced at the 5â€² end of the PCR fragment while a SpeI site was introduced at the 3â€² end with primer 04. The PCR fragment obtained and the PHIL-D2-MOD vector were both restricted by NcoI and SpeI, purified on agarose gel and ligated to create the integrative plasmid pRIT14598.

To construct pRIT14599, a 910 bp DNA fragment corresponding to the nef-tat-His coding sequence was ligated between the EcoRI blunted(T4 polymerase) and NcoI sites of the PHIL-D2-MOD vector. The nef-tat-His coding fragment was obtained by XbaI blunted(T4 polymerase) and NcoI digestions of pRIT14596.

1.2 Transformation of Pichia Pastoris Strain GS115(his4)

To obtain Pichia pastoris strains expressing Nef-His, Tat-His and the fusion Nef-Tat-His, strain GS115 was transformed with linear NotI fragments carrying the respective expression cassettes plus the HIS4 gene to complement his4 in the host genome.Transformation of GS115 with NotI-linear fragments favors recombination at the AOXI locus.

Multicopy integrant clones were selected by quantitative dot blot analysis and the type of integration, insertion (Mut⁺phenotype) or transplacement (Mut^sphenotype), was determined.

From each transformation, one transformant showing a high production level for the recombinant protein was selected:

Strain Y1738 (Mut⁺ phenotype) producing the recombinant Nef-His protein, a myristylated 215 amino acids protein which is composed of:

Myristic acid
methionine, created by the use of NcoI cloning site of PHIL-D2-MOD vector
205 aa of Nefprotein(starting at a.a.2 and extending to a.a.206)
A threonine and a serine created by the cloning procedure (cloning at SpeI site of PHIL-D2-MOD vector.
One glycine and six histidines.

Strain Y1739 (Mut⁺ phenotype) producing the Tat-His protein, a 95 amino acid protein which is composed of:

A methionine created by the use of NcoI cloning site
85 aa of the Tat protein(starting at a.a.2 and extending to aa.86)
A threonine and a serine introduced by cloning procedure
One glycine and six histidines

Strain Y1737 (Mut^sphenotype) producing the recombinant Nef-Tat-His fusion protein, a myristylated 302 amino acids protein which is composed of:

Myristic acid
A methionine, created by the use of NcoI cloning site
205a.a of Nef protein(starting at aa.2 and extending to a.a.206)
A threonine and a serine created by the cloning procedure
85a.a. of the Tat protein(starting at aa.2 and extending to a.a.86)
A threonine and a serine introduced by the cloning procedure
One glycine and six histidines

EXAMPLE 2 Expression of HIV-1 Tat-Mutant in Pichia Pastoris

A mutant recombinant Tat protein has also been expressed. The mutant Tat protein must be biologically inactive while maintaining its immunogenic epitopes.

A double mutant tat gene, constructed by D.Clements (Tulane University) was selected for these constructs.

This tat gene (originates from BH10 molecular clone) bears mutations in the active site region (Lys41â†’Ala)and in RGD motif (Arg78â†’Lys and Asp80â†’Glu) (Virology 235: 48-64, 1997).

The mutant tat gene was received as a cDNA fragment subcloned between the EcoRI and HindIII sites within a CMV expression plasmid (pCMVLys41/KGE)

2.1 Construction of the Integrative Vectors

pRIT14912(encoding Tat mutant-His protein) and pRIT14913(encoding fusion Nef-Tat mutant-His).

The tat mutant gene was amplified by PCR from the pCMVLys41/KGE plasmid with primers 05 and 04 (see section 1.lconstruction of pRIT14598)

To construct pRIT14913, the tat mutant gene was amplified by PCR from the pCMVLys41/KGE plasmid with primers 03 and 04.

â€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒSpeIPRIMER 03: 5â€² ATCGTACTAGT.GAG.CCA.GTA.GAT.C 3â€²(Seq ID NO 3) â€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒSpeIPRIMER 04: 5â€² CGGCTACTAGTTTCCTTCGGGCCT 3â€²(Seq ID NO 4)

The PCR fragment obtained and the plasmid pRIT14597 (expressing Nef-His protein) were both digested by Spel restriction enzyme, purified on agarose gel and ligated to create the integrative plasmid pRIT14913

2.2 Transformation of Pichia Pastoris Strain GS115

Pichia pastoris strains expressing Tat mutant-His protein and the fusion Nef-Tat mutant-His were obtained, by applying integration and recombinant strain selection strategies previously described in section 1.2.

Two recombinant strains producing Tat mutant-His protein, a 95 amino-acids protein, were selected: Y1775 (Mut⁺ phenotype) and Y1776(Mut^sphenotype).

One recombinant strain expressing Nef-Tat mutant-His fusion protein, a 302 amino-acids protein was selected: Y1774(Mut⁺ phenotype).

EXAMPLE 3 Fermentation of Pichia Pastoris Producing Recombinant TAT-HIS.

A typical process is described in the table hereafter.

Fermentation includes a growth phase (feeding with a glycerol-based medium according to an appropriate curve) leading to a high cell density culture and an induction phase (feeding with a methanol and a salts/micro-elements solution). During fermentation the growth is followed by taking samples and measuring their absorbance at 620 nm. During the induction phase methanol was added via a pump and its concentration monitored by Gas chromatography (on culture samples) and by on-line gas analysis with a Mass spectrometer. After fermentation the cells were recovered by centrifugation at 5020 g during 30â€² at 2-8Â° C. and the cell paste stored at âˆ’20Â° C. For further work cell paste was thawed, resuspended at an OD (at 620 nm) of 150 in a buffer (Na2HPO4 pH7 50 mM, PMSF 5%, Isopropanol 4 mNM) and disrupted by 4 passages in a DynoMill (room 0.6L, 3000 rpm, 6L/H, beads diameter of 0.40-0.70 mm).

For evaluation of the expression samples were removed during the induction, disrupted and analyzed by SDS-Page or Western blot. On Coomassie blue stained SDS-gels the recombinant Tat-his was clearly identified as an intense band presenting a maximal intensity after around 72-96H induction.

Thawing of a Working seed vialâ†“Solid precultureSynthetic medium: YNB +30Â° C., 14-16 Hglucose + agarâ†“Liquid preculture in two 2 LSynthetic medium: 2 Ã— 400 mlerlenmeyerYNB + glycerol30Â° C., 200 rpmStop when OD > 1 (at 620 nm)â†“Inoculation of a 20 L fermentor5 L initial medium (FSC006AA)3 ml antifoam SAG471 (from Witco)Set-points:Temperature:30Â° C.Overpressure:0.3 bargAir flow:20 Nl/minDissolved O2:regulated >40%pH: regulated at 5 by NH₄OHâ†“Fed-batch fermentation: growthFeeding with glycerol-basedphasemedium FFB005AADuration around 40 HFinal OD between 200-500OD (620 nm)Fed-batch fermentation:Feeding with methanol andinduction phasewith a salt/micro-elementsDuration: up to 97 Hsolution (FSE021AB).â†“Centrifugation5020 g/30 min/2-8Â° C.â†“Recover cell paste and storeat âˆ’20Â° C.â†“Thaw cells and resuspend atBuffer: Na2HPO4 pH7 50 mM,OD150 (620 nm) in bufferPMSF 5%, Isopropanol 4 mMâ†“Cell disruption in Dyno-millDyno-mill: (room 0.6 L. 30004 passagesrpm, 6 L/H, beads diameter of0.40-0.70 mm).â†“Transfer for extraction/purification

Media used for fermentation:

Solid preculture: (YNB + glucose + agar)Glucose:â€ƒâ€ƒâ€‰10 g/lNa2MoO4.2H2O:â€ƒ0.0002 g/lAcide folique:KH2PO4:â€‚â€ƒâ€ƒâ€‰1 g/lMnSO4.H2O:â€ƒ0.0004 g/lInositol:â€ƒâ€‚0.064 g/lMgSO4.7H2O:â€ƒâ€ƒ0.5 g/lH3BO3:â€ƒ0.0005 g/lPyridoxine:â€ƒâ€‚0.008 g/lCaC12.2H2O:â€ƒâ€ƒ0.1 g/lKI:â€ƒ0.0001 g/lThiamine:â€ƒâ€‚0.008 g/lNaCl:â€ƒâ€ƒ0.1 g/lCoCl2.6H2O:â€‚0.00009 g/lNiacine:0.000032 g/lFeCl3.6H2O:â€‚0.0002 g/lRiboflavine:0.000016 g/lPanthotÃ¨nate Ca:â€ƒâ€‚0.008 g/lCuSO4.5H2O:0.00004 g/lBiotine:0.000064 g/lPara-aininobenzoic acid:ZnSO4.7H2O:â€‚0.0004 g/l(NH4)2SO4:â€ƒâ€ƒâ€ƒâ€‰5 g/lAgarâ€ƒâ€ƒâ€‚â€‰18 g/l

Liquid preculture, (YNB + glycerol)Glycerol:2% (v/v)Na2MoO4.2H2O:â€ƒ0.0002 g/lAcide folique:KH2PO4:â€ƒâ€ƒâ€‚â€‰1 g/lMnSO4.H2O:â€ƒ0.0004 g/lInositol:â€ƒâ€‚0.064 g/lMgSO4.7H2O:â€ƒâ€ƒ0.5 g/lH3BO3:â€ƒ0.0005 g/lPyridoxine:â€ƒâ€‚0.008 g/lCaCl2.2H2O:â€ƒâ€ƒ0.1 g/lKI:â€ƒ0.0001 g/lThiamine:â€ƒâ€‚0.008 g/lNaCl:â€ƒâ€ƒ0.1 g/lCoCl2.6H2O:â€‚0.00009 g/lNiacme:0.000032 g/lFeCl3.6H2O:â€‚0.0002 g/lRiboflavine:0.000016 g/lPanthotÃ¨nate Ca:â€ƒâ€‚0.008 g/lCuSO4.5H2O:0.00004 g/lBiotine:0.000064 g/lPara-aminobenzoic acid:ZnSO4.7H2O:â€‚0.0004 g/l(NH4)2SO4:â€ƒâ€ƒâ€ƒâ€‰5 g/l

Initial fermentor charge: (TSC006AA)(NH4)₂SO4:6.4g/lKH2PO4:9g/lNa2MoO4.2H2O:2.04mg/lMgSO4.7H2O:4.7g/lMnSO4.H2O:4.08mg/1CaCl2.2H2O:0.94g/lH3BO3:5.1mg/lFeCl3.6H2O:10mg/lKI:1.022mg/lHCl:1.67ml/lCoCl2.6H2O:0.91mg/lCuSO4.5H2O:0.408mg/lNaCl:0.06g/lZnSO4.7H2O:4.08mg/lBiotine:0.534mg/l

Feeding solution used for growth phase (FFB005AA)GlycÃ©rol:38.7%v/vNa2MoO4.2H2O:5.7mg/lMgSO4.7H2O:13g/lCuSO4.5H2O:1.13mg/lCaCl2.2H2O:2.6g/lCoCl2.6H2O:2.5mg/lFeCl3.6H2O:27.8mg/lH3BO3:14.2mg/lZnSO4.7H2O11.3mg/lBiotine:1.5mg/lMnSO4.H2O:11.3mg/lKI:2.84mg/lKH2PO4:24.93g/lNaCl:0.167g/l

Feeding solution of salts and micro-elementsused during induction (FSE021AB):KH2PO4:45g/lNa2MoO4.2H2O:10.2mg/lMgSO4.7H2O:23.5g/lMnSO4.H2O:20.4mg/lCaCl2.2H2O:4.70g/lH3BO3:25.5mg/lNaCl:0.3g/lKI:5.11mg/lHCl:8.3ml/lCoCl2.6H2O:4.55mg/lCuSO4.5H2O:2.04mg/lFeCl3.6H2O:50.0mg/lZnSO4.7H2O:20.4mg/lBiotine:2.70mg/l

EXAMPLE 4 Purification of Nef-Tat-His Fusion Protein (Pichia Pastoris)

The purification scheme has been developed from 146 g of recombinant Pichia pastoris cells (wet weight) or 2L Dyno-mill homogenate OD 55. The chromatographic steps are performed at room temperature. Between steps, Nef-Tat positive fractions are kept overnight in the cold room (+4Â° C.); for longer time, samples are frozen at âˆ’20Â° C.

146 g of Pichia pastoriscellsâ†“HomogenizationBuffer: 2 L 50 mM PO₄pH 7.0final OD: 50Dyno-mill disruption(4 passes)â†“CentrifugationJA10 rotor/9500 rpm/30 min/room temperatureâ†“Dyno-mill Pelletâ†“WashBuffer: +2 L 10 mM PO₄(1 h - 4Â° C.)pH 7.5-150 mM - NaCl0.5% empigenâ†“CentrifugationJA10 rotor/9500 rpm/30 min/room temperatureâ†“Pelletâ†“SolubilisationBuffer: +660 ml 10 mM PO₄pH(O/N - 4Â° C.)7.5-150 mM NaCl - 4.0 M GuHClâ†“Reduction+0.2 M 2-mercaptoethanesulfonic(4 H - room temperature -acid, sodium salt (powder addition)/in the dark)pH adjusted to 7.5 (with 0.5 M NaOHsolution) before incubationâ†“reaction with+0.25 M Iodoacetamide (powderiodoacetamideaddition)/pH adjusted to 7.5(carbamidomethylation)(with 0.5 M NaOH solution) before(Â½ h - room temperature -incubationin the dark)â†“Immobilized metalEquilibration buffer: 10 mM PO₄ion affinitypH 7.5-150 mM NaCl - 4.0 Mchromatography onGuHClNi⁺⁺-NTA-AgaroseWashing buffer: 1) Equilibration(Qiagen - 30 ml of resin)buffer2) 10 mM PO₄pH 7.5-150 mM NaCl -6 M Urea3) 10 mM PO₄pH 7.5-150 mM NaCl -6 M Urea - 25 mM ImidazolElution buffer: 10 mM PO₄pH7.5-150 mM NaCl - 6 M Urea -0.5 M Imidazolâ†“DilutionDown to an ionic strength of18 mS/cm²Dilution buffer: 10 mM PO₄pH7.5-6 M Ureaâ†“Cation exchangeEquilibration buffer: 10 mM PO₄chromatography on SPpH 7.5-150 mM NaCl - 6.0 MSepharose FFUrea(Pharmacia - 30 ml ofWashing buffer: 1) Equilibrationresin)buffer2) 10 mM PO₄pH 7.5-250 mM NaCl -6 M UreaElution buffer: 10 mM Borate pH9.0-2 M NaCl - 6 M Ureaâ†“Concentrationup to 5 mg/ml10 kDa Omega membrane(Filtron)â†“Gel filtrationElution buffer: 10 mM PO₄pHchromatography on7.5-150 mM NaCl - 6 M UreaSuperdex200 XK 16/605 ml of sample/injection [Image Omitted]

5(Pharmacia - 120 ml ofinjectionsresin.)â†“DialysisBuffer. 10 mM PO₄pH 6.8-150(O/N - 4Â° C.)mM NaCl - 0.5 M Arginin*â†“Sterile filtrationMillex GV 0.22 Î¼m
*ratio: 0.5 M Arginin for a protein concentration of 1600 Î¼g/ml.

Purity

The level of purity as estimated by SDS-PAGE is shown in FIG. 3 by Daiichi Silver Staining and in FIG. 4 by Coomassie blue G250.

After Superdex200 step: >95%
After dialysis and sterile. filtration steps: >95%

Recovery

51 mg of Nef-Tat-his protein are purified from 146 g of recombinant Pichia pastoris cells (=2L of Dyno-mill homogenate OD 55)

EXAMPLE 5 Purification of Oxidized NEF-TAT-HIS Fusion Protein in Pichia Pastoris

The purification scheme has been developed from 73 g of recombinant Pichia pastoris cells (wet weight) or 1 L Dyno-mill homogenate OD 50. The chromatographic steps are performed at room temperature. Between steps , Nef-Tat positive fractions are kept overnight in the cold room (+4Â° C.) ; for longer time, samples are frozen at âˆ’20Â° C.

73 g of Pichia pastoriscellsâ†“HomogenizationBuffer: 1 L 50 mM PO₄pH 7.0 -Pefabloc 5 mMfinal OD: 50â†“Dyno-mill disruption(4 passes)â†“CentrifugationJA10 rotor/9500 rpm/30 min/roomtemperatureâ†“Dyno-mill Pelletâ†“WashBuffer: +1 L 10 mM PO₄pH 7.5-150(2 h - 4Â° C.)mM NaCl - 0.5% Empigenâ†“CentrifugationJA10 rotor/9500 rpm/30 min/roomtemperatureâ†“Pelletâ†“SolubilisationBuffer: +330 ml 10 mM PO₄pH(O/N - 4Â° C.)7.5-150 mM NaCl - 4.0 M GuHClâ†“Immobilized metalEquilibration buffer: 10 mM PO₄pHion affinity7.5-150 mM NaCl - 4.0 M GuHClchromatography onWashing buffer: 1) Equilibration bufferNi⁺⁺-NTA-Agarose2) 10 mM PO₄pH 7.5-150 mM(Qiagen - 15 ml of resin)NaCl - 6 M Urea3) 10 mM PO₄pH 7.5-150 mMNaCl - 6 M Urea - 25 mM ImidazolElution buffer: 10 mM PO₄pH7.5-150 mM NaCl - 6 M Urea -0.5 M Imidazolâ†“DilutionDown to an ionic strength of 18 mS/cm²Dilution buffer: 10 mM POa pH 7.5-6M Ureaâ†“Cation exchangeEquilibration buffer: 10 mM PO₄pHchromatography on SP7.5-150 mM NaCl - 6.0 M UreaSepharose FFWashing buffer: 1) Equilibration buffer(Pharmacia - 7 ml of2) 10 mM PO₄pH 7.5-250 mM NaCl -resin)6 M UreaElution buffer: 10 mM Borate pH9.0-2 M NaCl - 6 M Ureaâ†“Concentrationup to 0.8 mg/ml10 kDa Omega membrane(Filtron)â†“DialysisBuffer: 10 mM PO₄pH 6.8-150 mM(O/N - 4Â° C.)NaCl - 0.5 M Argininâ†“Sterile filtrationMillex GV 0.22 Î¼m
[Image Omitted]

Level of purity estimated by SDS-PAGE is shown in FIG. 6 (Daiichi Silver Staining, Coomassie blue G250, Western blotting)

After dialysis and sterile filtration steps: >95%

[Image Omitted]

Recovery (evaluated by a colorimetric protein assay: DOC TCA BCA)

2.8 mg of oxidized Nef-Tat-his protein are purified from 73 g of recombinant Pichia pastoris cells (wet weight) or 1 L of Dyne-mill homogenate OD 50.

EXAMPLEe 6 Purification of Reduced TAT-HIS Protein (Pichia Pastoris)

The purification scheme has been developed from 160 g of recombinant Pichia pastoris cells (wet weight) or 2L Dyno-mill homogenate OD 66. The chromatographic steps are performed at room temperature. Between steps, Tat positive fractions are kept overnight in the cold room (+4Â° C.); for longer time, samples are frozen at âˆ’20Â° C.

160 g of Pichia pastoriscellsâ†“HomogenizationBuffer: +2 L 50 mM PO₄pH7.0-4 mM PMSFfinal OD: 66â†“Dyno-mill disruption(4 passes)â†“CentrifugationJA10 rotor/9500 rpm/30 min/roomtemperatureâ†“Dyno-mill Pelletâ†“WashBuffer: +2 L 10 mM PO₄pH(1 h - 4Â° C.)7.5-150 mM NaCl - 1% Empigenâ†“CentrifugationJA10 rotor/9500 rpm/30 min/roomtemperatureâ†“Pelletâ†“SolubilisationBuffer: +660 ml 10 mM PO₄pH(O/N - 4Â° C.)7.5-150 mM NaCl - 4.0 M GuHClâ†“CentrifugationJA10 rotor/9500 rpm/30 min/roomtemperatureâ†“Reduction+0.2 M 2-mercaptoethanesulfonic(4 H - room temperature -acid, sodium salt (powder addition)/in the dark)pH adjusted to 7.5 (with 1 MNaOH solution) before incubationâ†“reaction with+0.25 M Iodoacetamideiodoacetamide(powder addition)/pH(Â½ h - room temperature -adjusted to 7.5 (with 1in the dark)M NaOH solution) beforeincubationâ†“Immobilized metalEquilibration buffer: 10 mMion affinityPO₄pH 7.5-150 mM NaCl -chromatography on4.0 M GuHClNi⁺⁺-NTA-AgaroseWashing buffer: 1) Equilibration(Qiagen - 60 ml of resin)buffer2) 10 mM PO₄pH 7.5-150 mMNaCl - 6 M Urea3) 10 mM PO₄pH 7.5-150 mMNaCl - 6 M Urea - 35 mMImidazolElution buffer: 10 mM PO₄pH 7.5-150 mM NaCl -6 M Urea - 0.5 M Imidazolâ†“DilutionDown to an ionic strengthof 12 mS/cmDilution buffer: 20 mM BoratepH 8.5-6 M Ureaâ†“Cation exchangeEquilibration buffer: 20 mMchromatography on SPBorate pH 8.5-150 mM NaCl -Sepharose FF6.0 M Urea(Pharmacia - 30 ml ofWashing buffer: Equilibrationresin)bufferElution buffer: 20 mM BoratepH 8.5-400 mM NaCl -6.0 M Ureaâ†“Concentrationup to 1,5 mg/ml10 kDa Omega membrane(Filtron)â†“DialysisBuffer: 10 mM PO₄pH 6.8-150(O/N - 4Â° C.)mM NaCl - 0.5 M Argininâ†“Sterile filtrationMillex GV 0.22 Î¼m
[Image Omitted]

Level of purity estimated by SDS-PAGE as shown in FIG. 7 (Daiichi Silver Staining, Coomassie blue G250, Western blotting):

After dialysis and sterile filtration steps: >95%

[Image Omitted]

Recovery (evaluated by a colorimetric protein assay: DOC TCA BCA)

48 mg of reduced Tat-his protein are purified from 160 g of recombinant Pichia pastoris cells (wet weight) or 2 L of Dyne-mill homogenate OD 66.

EXAMPLE 7 Purification of Oxidized Tat-his Protein (Pichia Pastoris)

The purification scheme has been developed from 74 g of recombinant Pichia pastoris cells (wet weight) or 1L Dyno-mill homogenate OD60. The chromatographic steps are performed at room temperature. Between steps, Tat positive fractions are kept overnight in the cold room (+4Â° C.); for longer time, samples are frozen at âˆ’20Â° C.

74 g of Pichia pastoriscellsâ†“HomogenizationBuffer: +1 L 50 mM PO₄pH7.0-5 mM Pefablocfinal OD: 60â†“Dyno-mill disruption(4 passes)â†“CentrifugationJA10 rotor/9500 rpm/30 min/roomtemperatureâ†“Dyno-mill Pelletâ†“WashBuffer: +1 L 10 mM PO₄pH(1 h - 4Â° C.)7.5-150 mM NaCl - 1% Empigenâ†“CentrifugationJA10 rotor/9500 rpm/30 min/roomtemperatureâ†“Pelletâ†“SolubilisationBuffer: +330 ml 10 mM PO₄pH(O/N - 4Â° C.)7.5-150 mM NaCl - 4.0 M GuHClâ†“CentrifugationJA10 rotor/9500 rpm/30 min/roomtemperatureâ†“Immobilized metalEquilibration buffer: 10 mM PO₄ion affinitypH 7.5-150 mM NaCl - 4.0 Mchromatography onGuHClNi⁺⁺-NTA-AgaroseWashing buffer: 1) Equilibration(Qiagen - 30 mlbufferof resin)2) 10 mM PO₄pH 7.5-150 mMNaCl - 6 M Urea3) 10 mM PO₄pH 7.5-150 mMNaCl - 6 M Urea - 35 mM ImidazolElution buffer: 10 mM PO₄pH7.5-150 mM NaCl - 6 M Urea -0.5 M Imidazolâ†“DilutionDown to an ionic strength of 12mS/cmDilution buffer: 20 mM BoratepH 8.5-6 M Ureaâ†“Cation exchangeEquilibration buffer: 20 mM Boratechromatography on SPpH 8.5-150 mM NaCl - 6.0 M UreaSepharose FFWashing buffer: 1) Equilibration(Pharmacia - 15bufferml of resin)2) 20 mM Borate pH 8.5-400 mMNaCl - 6.0 M UreaElution buffer: 20 mM PiperazinepH 11.0-2 M NaCl - 6 M Ureaâ†“Concentrationup to 1.5 mg/ml10 kDa Omega membrane(Filtron)â†“DialysisBuffer: 10 mM PO₄pH 6.8-150(O/N - 4Â° C.)mM NaCl - 0.5 M Argininâ†“Sterile filtrationMillex GV 0.22 Î¼m
[Image Omitted]

Level of purity estimated by SDS-PAGE as shown in FIG. 8 (Daiichi Silver Staining, Coomassie blue G2SO, Western blotting):

After dialysis and sterile filtration steps: >95%

[Image Omitted]

Recovery (evaluated by a colorimetric protein assay: DOC TCA BCA)

19 mg of oxidized Tat-his protein are purified from 74 g of recombinant Pichia pastoris cells (wet weight) or 1 L of Dyno-mill homogenate OD 60.

EXAMPLE 8 Purification of SIV Reduced NEF-HIS Protein (Pichia Pastoris)

The purification scheme has been developed from 340 g of recombinant Pichia pastoris cells (wet weight) or 4 L Dyno-mill homogenate OD 100. The chromatographic steps are performed at room temperature. Between steps , Nef positive fractions are kept overnight in the cold room (+4Â° C.); for longer time, samples are frozen at âˆ’20Â° C.

340 g of Pichia pastoriscellsâ†“HomogenizationBuffer: 4 L 50 mM PO₄pH 7.0 -PMSF 4 mMfinal OD: 100â†“Dyno-mill disruption(4 passes)â†“CentrifugationJA10 rotor/9500 rpm/60 min/roomtemperatureâ†“Dyno-mill Pelletâ†“SolubilisationBuffer: +2.6 L 10 mM PO₄pH 7.5-150(O/N - 4Â° C.)mM NaCl - 4.0 M GuHClâ†“CentrifugationJA10 rotor/9500 rpm/30 min/roomtemperatureâ†“Reduction+0.2 M 2-mercaptoethanesulfonic(4 H - room temperature -acid, sodium salt (powder addition)/in the dark)pH adjusted to 7.5 (with 1 M NaOHsolution) before incubationâ†“Reaction with+0.25 M Iodoacetamide (powderiodoacetamideaddition)/pH adjusted to 7.5 (with 1(Â½ h - room temperature -M NaOH solution) before incubationin the dark)â†“Immobilized metalEquilibration buffer: 10 mM PO₄pHion affinity7.5-150 mM NaCl - 4.0 M GuHClchromatography onWashing buffer: 1) Equilibration bufferNi⁺⁺-NTA-Agarose2) 10 mM PO₄pH 7.5-150 mM NaCl -(Qiagen - 40 ml of resin)6 M Urea - 25 mM ImidazolElution buffer: 10 mM PO₄pH 7.5-150mM NaCl - 6 M Urea - 0.5 M Imidazolâ†“Concentrationup to 3 mg/ml10 kDa Omega membrane(Filtron)â†“Gel filtrationElution buffer: 10 mM PO₄pH 7.5-150chromatography onmM NaCl - 6 M UreaSuperdex 200(Pharmacia - 120 ml ofresin)â†“Concentrationup to 1.5 mg/ml10 kDa Omega membrane(Filtron)â†“DialysisBuffer: 10 mM PO₄pH 6.8-150(O/N - 4Â° C.)mM NaCl - Empigen 0.3%â†“Sterile filtrationMillex GV 0.22 Î¼m
[Image Omitted]

Level of purity estimated by SDS-PAGE as shown in FIG. 9 (Daiichi Silver Staining, Coomassie blue G250, Western blotting):

After dialysis and sterile filtration steps: >95%

[Image Omitted]

Recovery (evaluated by a colorimetric protein assay: DOC TCA BCA)

20 mg of SIV reduced Nef-bis protein are purified from 340 g of recombinant Pichia pastoris cells (wet weight) or 4 L of Dyno-mill homogenate OD 100.

EXAMPLE 9 Purification of HIV Reduced NEF-HIS Protein (Pichia Pastoris)

The purification scheme has been developed from 160 g of recombinant Pichia pastoris cells (wet weight) or 3 L Dyno-mill homogenate OD 50. The chromatographic steps are performed at room temperature. Between steps , Nef positive fractions are kept overnight in the cold room (+4Â° C.); for longer time, samples are frozen at âˆ’20Â° C.

160 g of Pichia pastoriscellsâ†“HomogenizationBuffer: 3 L 50 mM PO₄pH 7.0 -Pefabloc 5 mM final OD: 50â†“Dyno-mill disruption(4 passes)â†“Freezing/Thawingâ†“CentrifugationJA10 rotor/9500 rpm/60 min/roomtemperatureâ†“Dyno-mill Pelletâ†“SolubilisationBuffer: +1 L 10 mM PO₄pH 7.5-150(O/N - 4Â° C.)mM NaCl - 4.0 M GuHClâ†“CentrifugationJA10 rotor/9500 rpm/60 min/roomtemperatureâ†“Reduction+0.1 M 2-mercaptoethanesulfonic(3 H - room temperature -acid, sodium salt (powder addition)/in the dark)pH adjusted to 7.5 (with 1 M NaOHsolution) before incubationâ†“Reaction with+0.15 M Iodoacetamide (powderiodoacetamideaddition)/pH adjusted to 7.5 (with 1(Â½ h - room temperature -M NaOH solution) before incubationin the dark)â†“Immobilized metalEquilibration buffer: 10 mM PO₄pHion affinity7.5-150 mM NaCl - 4.0 M GuHClchromatography onWashing buffer. 1) Equilibration bufferNi⁺⁺-NTA-Agarose2) 10 mM PO₄pH 7.5-150 mM(Qiagen - 10 ml of resin)NaCl - 6 M Urea3) 10 mM PO₄pH 7.5-150 mMNaCl - 6 M Urea - 25 mM ImidazolElution buffer: 10 mM Citrate pH6.0-150 mM NaCl - 6 M Urea -0.5 M Imidazolâ†“Concentrationup to 3 mg/ml10 kDa Omega membrane(Filtron)â†“Gel filtrationElution buffer: 10 mM PO₄pHchromatography on7.5-150 mM NaCl - 6 M UreaSuperdex 200(Pharmacia - 120 ml ofresin)â†“DialysisBuffer: 10 mM PO₄pH 6.8-150 mM(O/N - 4Â° C.)NaCl - 0.5 M Argininâ†“Sterile filtrationMillex GV 0.22 Î¼m
[Image Omitted]

Level of purity estimated by SDS-PAGE as shown in FIG. 10 (Daiichi Silver Staining, Coomassie blue G250, Western blotting):

After dialysis and sterile filtration steps: >95%

[Image Omitted]

Recovery (evaluated by a colorimetric protein assay: DOC TCA BCA)

20 mg of HIV reduced Nef-his protein are purified from 160 g of recombinant Pichia pastoris cells (wet weight) or 3 L of Dyno-mill homogenate OD 50.

EXAMPLE 10 Expression of SIV nef Sequence in Pichia Pastoris

In order to evaluate Nef and Tat antigens in the pathogenic SHIV challenge model, we have expressed the Nef protein of simian immunodeficiency virus (SIV) of macaques, SIVmac239 (Aids Research and Human Retroviruses, 6:1221-1231,1990). In the Nef coding region, SIV mac 239 has an in-frame stop codon after 92aa predicting a truncated product of only 10 kD. The remainder of the Nef reading frame is open and would be predicted to encode a protein of 263aa (30 kD) in its fully open form.

Our starting material for SIVmac239 nef gene was a DNA fragment corresponding to the complete coding sequence, cloned on the LX5N plasmid (received from Dr R. C. Desrosiers, Southborough, Mass., USA).

This SIV nef gene is mutated at the premature stop codon (nucleotide G at position 9353 replaces the original T nucleotide) in order to express the full-length SIVmac239 Nef protein.

To express this SIV nef gene in Pichia pastoris, the PHIL-D2-MOD Vector (previously used for the expression of HIV-1 nef and tat sequences) was used. The recombinant protein is expressed under the control of the inducible alcohol oxidase (AOX1) promoter and the c-terminus of the protein is elongated by a Histidine affinity tail that will facilitate the purification.

10.1 Construction of the Interactive Vector pRIT 14908

To construct pRIT 14908, the SIV nef gene was amplified by PCR from the pLX5N/SIV-NEF plasmid with primers SNEF1 and SNEF2.

PRIMER SNEF1: 5â€² ATCGTCCATG.GGTGGAGCTATTTT 3â€²(Seq ID No: 6)â€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒNcoIPRIMER SNEF2: 5â€² CGGCTACTAGTGCGAGTTTCCTT 3â€²(Seq ID No: 7)â€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒâ€ƒSpeI

The SIV nefDNA region amplified starts at nucleotide 9077 and terminates at nucleotide 9865 (Aids Research and Human Retroviruses, 6:1221-1231,1990).

An NcoI restriction site (with carries the ATG codon of the nef gene) was introduced at the 5â€² end of the PCR fragment while a SpeI site was introduced at the 3â€² end. The PCR fragment obtained and the integrative PHIL-D2-MOD vector were both restricted by NcoI and SpeI. Since one NcoI restriction site is present on the SIV nef amplified sequence (at position 9286), two fragments of respectively Â±200 bp and Â±600 bp were obtained, purified on agarose gel and ligated to PHIL-D2-MOD vector. The resulting recombinant plasmid received, after verification of the nef amplified region by automated sequencing, the pRIT 14908 denomination.

10.2 Transformotion of Pichia Pastoris Strain GS115(his4)

To obtain Pichia pastoris strain expressing SIV nef-His, strain GS115 was transformed with a linear NotI fragment carrying only the expression cassette and the HIS4 gene (FIG. 11).

This linear NotI DNA fragment ,with homologies at both ends with AOX1 resident P. pastoris gene, favors recombination at the AOX1 locus.

Multicopy integrant clones were selected by quantitative dot blot analysis. One transformant showing the best production level for the recombinant protein was selected and received the Y1772 denonination. train Y1772 produces the recombinant SIV Nef-His protein, a 272 amino acids rotein which would be composed of:

Myristic acid
A methionine, created by the use of NcoI cloning site of PHIL-D2-MOD vector.
262 amino acids (aa) of Nef protein (starting at aa 2 and extending to aa 263, see FIG. 12)
A threonine and a serine created by the cloning procedure (cloning at SpeI site of PHIL-D2-MOD vector (FIG. 11â€”includes Seq ID No: 29).
One glycine and six histidines.

Nucleic and Protein sequences are shown in FIG. 12 (Seq ID Nos: 30 and 31).

10.3 Characterization of the Expressed Product of Strain Y1772

Expression Level

After 16 hours induction in medium containing 1% methanol as carbon source, abundance of the recombinant Nef-His protein, was estimated at 10% of total protein (FIG. 13, lanes 3-4).

Solubility

Induced cultures of recombinant strain Y1772 producing the Nef-His protein were centrifuged. Cell pellets were resuspended in breaking buffer, disrupted with 0.5mm glass beads and the cell extracts were centrifuged. The proteins contained in the insoluble pellet (P) and in the soluble supematant (S) were compared on a Coomassie Blue stained SDS-PAGE10%.

As shown in FIG. 13, the majority of the recombinant protein from strain Y1772 (lanes 3-4) is associated with the insoluble fraction.

Strain Y1772 which presents a satisfactory recombinant protein expression level is used for the production and purification of SIV Nef-His protein.

EXAMPLE 11 Expression of GP120 in CHO

A stable CHO-K1 cell line which produces a recombinant gP120 glycoprotein has been established. Recombinant gP120 glycoprotein is a recombinant truncated form of the gP120 envelope protein of HIV-1 isolate W61D. The protein is excreted into the cell culture medium, from which it is subsequently purified.

Construction of gp120 Transfection Plasmid pRIT13968

The envelope DNA coding sequence (including the 5â€²exon of tat and rev) of HIV-1 isolate W61D was obtained (Dr. Tersmette, CCB, Amsterdam) as a genomic gp160 envelope containing plasmid W61D (Nco-XhoI). The plasmid was designated pRIT13965.

In order to construct a gp120 expression cassette a stop codon had to be inserted at the amino acid glu 515 codon of the gp160 encoding sequence in pRIT13965 using a primer oligonucleotide sequence (DIR 131) and PCR technology. Primer DIR 131 contains three stop codons (in all open reading frames) and a SalI restriction site.

The complete gp120 envelope sequence was then reconstituted from the N-terminal BamHl-Dral fragment (170 bp) of a gp160 plasmid subclone pW61d env (pRIT13966) derived from pRIT13965, and the DraI-SalI fragment (510 bp) generated by PCR from pRIT13965. Both fragments were gel purified and ligated together into the E.coli plasmid pUC18, cut first by SalI (klenow treated), and then by BamH1. This resulted in plasmid pRIT13967. The gene sequence of the XmaI-SalI fragment (1580 bp) containing the gp120 coding cassette was sequenced and found to be identical to the predicted sequence. Plasmid RIT13967 was ligated into the CHO GS-expression vector pEE14 (Celltech Ltd., UK) by cutting first with BclI (klenow treated) and then by XmaI. The resulting plasmid was designated pRIT13968.

Preparation of Master Cell Bank

The gp120-construct (pRIT13968) was transfected into CHO cells by the classical CaPO₄-precipitation/glycerol shock procedure. Two days later the CHOK1 cells were subjected to selective growth medium (GMEM+methionine sulfoximine (MSX) 25 Î¼M+Glutamate+asparagine+10% Foetal calf serum). Three chosen transfectant clones were further amplified in 175 m²flasks and few cell vials were stored at âˆ’80Â° C. C-env 23,9 was selected for further expansion.

A small prebank of cells was prepared and 20 ampoules were frozen. For preparation of the prebank and the MCB, cells were grown in GMEM culture medium, supplemented with 7.5% fetal calf serum and containing 50 Î¼M MSX. These cell cultures were tested for sterility and mycoplasma and proved to be negative.

The Master Cell Bank CHOK1 env 23.9 (at passage 12) was prepared using cells derived from the premaster cell bank. Briefly, two ampoules of the premaster seed were seeded in medium supplemented with 7.5% dialysed foetal bovine serum. The cells were distributed in four culture flasks and cultured at 37Â° C. After cell attachment the culture medium was changed with fresh medium supplemented with 50 Î¼M MSX. At confluence, cells were collected by trypsination and subcultured with a 1/8 split ratio in T-flasksâ€”roller bottleâ€”cell factory units. Cells were collected from cell factory units by trypsination and centrifugation. The cell pellet was resuspended in culture medium supplemented with DMSO as cryogenic preservative. Ampoules were prelabelled, autoclaved and heat-sealed (250 vials). They were checked for leaks and stored overnight at âˆ’70Â° C. before storage in liquid nitrogen.

Cell Culture And Production Of Crude Harvest

Two vials from a master cell bank are thawed rapidly. Cells are pooled and inoculated in two T-flasks at 37Â°Â±1Â° C. with an appropriate culture medium supplemented with 7.5% dialysed foetal bovine (FBS) serum. When reaching confluence (passage 13), cells are collected by trypsinisation, pooled and expanded in 10 T-flasks as above. Confluent cells (passage 14) are trypsinised and expanded serially in 2 cell factory units (each 6000 cm²; passage 15), then in 10 cell factories (passage 16). The growth culture medium is supplemented with 7.5% dialysed foetal bovine (FBS) serum and 1% MSX. When cells reach confluence, the growth culture medium is discarded and replaced by â€œproduction mediumâ€ containing only 1% dialysed foetal bovine serum and no MSX. Supernatant is collected every two days (48 hrs-interval) for up to 32 days. The harvested culture fluids are clarified immediately through a 1.2-0.22 Î¼m filter unit and kept at âˆ’20Â° C. before purification.

EXAMPLE 12 Purification of HIV GP 120 (W61D CHO) From Cell Culture Fluid

All purification steps are performed in a cold room at 2-8Â° C. pH of buffers are adjusted at this temperature and are filtered on 0.2 Î¼m filter. They are tested for pyrogen content (LAL assay). Optical density at 280 nm, pH and conductivity of column eluates are continuously monitored.

(i) Clarified Culture Fluid

The harvested clarified cell culture fluid (CCF) is filter-sterilized and Tris buffer, pH 8.0 is added to 30 mM final concentration. CCF is stored frozen at âˆ’20Â° C. until purification.

(ii) Hydrophobic Interaction Chromatography

After thawing, ammonium sulphate is added to the clarified culture fluid up to 1 M. The solution is passed overnight on a TSK/TOYOPEARL-BUTYL 650 M (TOSOHAAS) column, equilibrated in 30 mM Tris bufferâ€”pH 8.0-1 M ammonium sulphate. Under these conditions, the antigen binds to the gel matrix. The column is washed with a decreasing stepwise ammonium sulphate gradient. The antigen is eluted at 30 mM Tris bufferâ€”pH 8.0-0.25 M ammonium sulphate.

(iii) Anion-Exchange Chromatography

After reducing the conductivity of the solution between 5 and 6 mS/cm, the gP120 pool of fractions is loaded onto a Q-sepharose Fast Flow (Pharmacia) column, equilibrated in Tris-saline bufferâ€”pH 8.0. The column is operated on a negative mode, i.e. gP120 does not bind to the gel, while most of the impurities are retained.

(iv) Concentration and Diafiltration by Ultrafiltration

In order to increase the protein concentration, the gP120 pool is loaded on a FILTRON membrane â€œOmega Screen Channelâ€ , with a 50 kDa cut-off. At the end of the concentration, the buffer is exchanged by diafiltration with 5 mM phosphate buffer containing CaCI₂0.3 mM, pH 7.0. If further processing is not performed immediately, the gP120 pool is stored frozen at âˆ’20Â° C. After thawing the solution is filtered onto a 0.2 Î¼M membrane in order to remove insoluble materiel.

(v) Chromatography on Hydroxyapatite

The gP120 UF pool is loaded onto a macro-Prep Ceramic Hydroxyapatite, type II (Biorad) column equilibrated in 5 mM phosphate buffer+CaCl₂0.3 mM, pH 7.0. The column is washed with the same buffer. The antigen passes through the column and impurities bind to the column.

(vi) Cation Exchange Chromatography

The gP120 pool is loaded on a CM/TOYOPEARL-650 S (TOSOHAAS) column equilibrated in acetate buffer 20 mM, pH 5.0. The column is washed with the same buffer, then acetate 20 mM, pH 5.0 and NaCl 10 mM. The antigen is then eluted by the same buffer containing 80 mM NaCl.

(vii) Ultrafiltration

In order to augment the virus clearance capacity of the purification process, an additional ultrafiltration step is carried out. The gP120 pool is subjected to ultrafiltration onto a FILTRON membrane â€œOmega Screen Channelâ€ , cut-off 150 kDa. This pore-size membrane does not retain the antigen. After the process, the diluted antigen is concentrated on the same type of membrane (Filtron) but with a cut-off of 50kDa.

(viii) Size Exclusion Gel Chromatography

The gP120 pool is applied to a SUPERDEX 200 (PHARMACIA) column in order to exchange the buffer and to eliminate residual contaminants. The column is eluted with phosphate buffer saline (PBS).

(ix) Sterile Filtration and Storage

Fractions are sterilized by filtration on a 0.2 Î¼M PVDF membrane (Millipore). After sterile filtration, the purified bulk is stored frozen at âˆ’20Â° C. up to formulation. The purification scheme is summarized by the flow sheet below.

[Image Omitted] Level of purity of the purified bulk estimated by SDS-PAGE analysis (Silver staining/Coomassie Blue/Western Blotting) is >95%.

[Image Omitted] Production yield is around 2.5 mg/L CCF (according to Lowry assay)â€”Global purification yield is around 25% (according to Elisa assay)

[Image Omitted] Purified material is stable 1 week at 37Â° C. (according to WB analysis)

Purification of gp120 from culture fluidMark âœ“ indicate steps that are critical for virus removal.CLARIFIED CULTURE FLUIDâ†“HYDROPHOBIC INTERACTION CHROMATOGRAPHY(BUTYL-TOYOPEARL 650 M)â†“ANION EXCHANGE CHROMATOGRAPHYâœ“NEGATIVE MODE) (Q-SEPHAROSE)â†“50 KD ULTRAFILTRATION(CONCENTRATION AND BUFFER EXCHANGE)â†“(STORAGE -20Â° C.)â†“HYDROXYAPATITE CHROMATOGRAPHY(NEGATIVE MODE)(MACROPREP CERAMIC HYDROXYAPATITE II)â†“CATION EXCHANGE CHROMATOGRAPHY(CM-TOYOPEARL 650 S)â†“150 KD ULTRAFILTRATIONâœ“(OMEGA MEMBRANES/FILTRON)â†“50 KD ULTRAFILTRATION(CONCENTRATION)â†“SIZE EXCLUSION CHROMATOGRAPHYâœ“(SUPERDEX 200)STERILE FILTRATIONâ†“PURIFIED BULKSTORAGE âˆ’20Â° C.

EXAMPLE 13 Vaccine Preparation

A vaccine prepared in accordance with the invention comprises the expression products of one or more DNA recombinants encoding an antigen. Furthermore, the formulations comprise a mixture of 3 de -0-acylated monophosphoryl lipid A 3D-MPL and QS21 in an oil/water emulsion or an oligonucleotide containing umnethylated CpG dinucleotide motifs and aluminium hydroxide as carrier.

3D-MPL: is a chemically detoxified form of the lipopolysaccharide (LPS) of the Gram-negative bacteria Salmonella Minnesota.

Experiments have shown that 3D-MPL combined with various vehicles strongly enhances both the humoral immunity and a T_H1type of cellular immunity.

QS21: is a saponin purified from a crude extract of the bark of the Quillaja Saponaria Molina tree, which has a strong adjuvant activity: it induces both antigen-specific lymphoproliferation and CTLs to several antigens.

Experiments have demonstrated a clear synergistic effect of combinations of 3D-MPL and QS21 in the induction of both humoral and T_H1type cellular immune responses.

The oil/water emulsion is composed of 2 oils (a tocopherol and squalene), and of PBS containing Tween 80 as emulsifier. The emulsion comprises 5% squalene, 5% tocopherol, 2% Tween 80 and has an average particle size of 180 nm (see WO 95/17210).

Experiments performed have proven that the adjunction of this O/W emulsion to 3D-MPL/QS21 further increases their immunostimulant properties.

Preparation of the Oil/Water Emulsion (2 Fold Concentrate)

Tween 80 is dissolved in phosphate buffered saline (PBS) to give a 2% solution in the PBS. To provide 100 ml two fold concentrate emulsion 5 g of DL alpha tocopherol and 5 ml of squalene are vortexed to mix thoroughly. 90 ml of PBS/Tween solution is added and mixed thoroughly. The resulting emulsion is then passed through a syringe and finally microfluidised by using an M110S Microfluidics machine. The resulting oil droplets have a size of approximately 180 mn.

Preparation of Oil in Water Formulation.

Antigens (100 Î¼g gp120, 20 Î¼g NefTat, and 20 Î¼g SIV Nef, alone or in combination) were diluted in 10 fold concentrated PBS pH 6.8 and H₂O before consecutive addition of the oil in water emulsion, 3D-MPL (50 Î¼g), QS21 (50 Î¼g) and 1 jig/ml thiomersal as preservative at 5 min interval. The emulsion volume is equal to 50% of the total volume (250 Î¼l for a dose of 500 Î¼l).

All incubations were carried out at room temperature with agitation.

CpG oligonucleotide (CpG) is a synthetic unmethylated oligonucleotide containing one or several CpG sequence motifs. CpG is a very potent inducer of T_H1type immunity compared to the oil in water formulation that induces mainly a mixed T_H1/T_H2response. CpG induces lower level of antibodies than the oil in water formulation and a good cell mediated immune response. CpG is expected to induce lower local reactogenicity.

Preparation of CpG oligonucleotide solution: CpG dry powder is dissolved in H₂O to give a solution of 5 mg/ml CpG.

Preparation of CpG Formulation.

The 3 antigens were dialyzed against NaCl 150 mM to eliminate the phosphate ions that inhibit the adsorption of gp120 on aluminium hydroxide. The antigens diluted in H₂O (100 Î¼g gp120, 20 Î¼g NefTat and 20 Î¼g SIV Nef) were incubated with the CpG solution (500 Î¼g CpG) for 30 min before adsorption on Al(OH)₃to favor a potential interaction between the His tail of NefTat and Nef antigens and the oligonucleotide (stronger immunostimulatory effect of CpG described when bound to the antigen compared to free CpG). Then were consecutively added at 5 min interval Al(OH)₃(500 Î¼g), 10 fold concentrated NaCl and 1 Î¼g/ml thiomersal as preservative.

All incubations were carried out at room temperature with agitation.

EXAMPLE 14 Immunization and SHIV Challenge Experiment in Rhesus Monkeys

First Study

Groups of 4 rhesus monkeys were immunized intramuscularly at 0, 1 and 3 months with the following vaccine compositions:

Group 1:Adjuvant 2+gp120Group 2:Adjuvant 2+gp120+NefTat+SIV NefGroup 3:Adjuvant 2+NefTat*+SIV NefGroup 4Adjuvant 6+gp120+NefTat+SIV NefGroup 5Adjuvant 2+NetTat+SIV NefGroup 6Adjuvant 2
Adjuvant 2 comprises squalene/tocopherol/Tween 80/3D-MPL/QS21 and Adjuvant 6 comprises alum and CpG.

Tat* represents mutated Tat, in which Lys41â†’Ala and in RGD motif Arg78â†’Lys and Asp80â†’Glu (Virology 235: 48-64, 1997).

One month after the last immunization all animals were challenged with a pathogenic SHIV (strain 89.6p). From the week of challenge (wkl 6) blood samples were taken periodically at the indicated time points to determine the % of CD4-positive cells among peripheral blood mononuclear cells by FACS analysis (FIG. 14) and the concentration of RNA viral genomes in the plasma by bDNA assay (FIG. 15).

Results

All animals become infected after challenge with SHIV_89.6p.

CD4-positive cells decline after challenge in all animals of groups 1, 3, 5 and 6 except one animal in each of groups 1 and 6 (control group). All animals in group 2 exhibit a slight decrease in CD4-positive cells and recover to baseline levels over time. A similartrend is observed in group 4 animals (FIG. 14).

Virus load data are almost the inverse of CD4 data. Virus load declines below the level of detection in {fraction (3/4)} group 2 animals (and in the one control animal that maintains its CD4-positive cells), and the fourth animal shows only marginal virus load. Most of the other animals maintain a high or intermediate virus load (FIG. 15).

Surprisingly, anti-Tat and anti-Nef antibody titres measured by ELISA were 2 to 3-fold higher in Group 3 (with mutated Tat) than in Group 5 (the equivalent Group with non-mutated Tat) throughout the course of the study.

At week 68 (56 weeks post challenge) all animals from the groups that had received the full antigen combination (groups 2 and 4) were still alive, while most of the animals in the other groupshad to be euthanized due to AIDS-like symptoms. The surviving animals per group were:

Group 1:2/4Group 2:4/4Group 3:0/4Group 44/4Group 50/4Group 61/4

Conclusions

The combination of gp120 and NefTat (in the presence of SIV Nef) prevents the loss of CD4-positive cells, reduces the virus load in animals infected with pathogenic SHIV_89.6p, and delays or prevents the development of AIDS-like disease symptoms, while gp120 or NefTat/SIV Nef alone do not protect from the pathologic consequences of the SHIV challenge.

The adjuvant 2 which is an oil in water emulsion comprising squalene, tocopherol and Tween 80, together with 3D-MPL and QS21 seems to have a stronger effect on the study endpoints than the alum/CpG adjuvant.

Second Study

A second rhesus monkey SHIV challenge study was conducted to confirm the efficacy of the candidate vaccine gp120/NefTat+adjuvant and to compare different Tat-based antigens. The study was conducted by a different laboratory.

The design of the study was as follows.

Groups of 6 rhesus monkeys were immunized at 0, 4 and 12 weeks with injections i.m. and challenged at week 16 with a standard dose of pathogenic SHIV_89.6p.

Group 1 is the repeat of Group 2 in the first study.

Group 1:Adjuvant 2+gp120+NetTat+SIV NefGroup 2:Adjuvant 2+gp120+Tat (oxidised)Group 3:Adjuvant 2+gp120+Tat (reduced)Group 4Adjuvant 2

The follow-up/endpoints were again % CD4-positive cells, virus load by RT-PCR, morbidity and mortality

Results

All animals except one in group 2 become infected after challenge with SHIV_89.6p. CD4-positive cells decline significantly after challenge in all animals of control group 4 and group 3, and in all but one animals of group 2. Only one animal in group 1 shows a marked decrease in CD4-positive cells. Unlike the animals from the first study, the monkeys in the second experiment display a stabilisation of CD4-positive cells at different levels one month after virus challenge (FIG. 16). The stabilisation is generally lower than the initial % of CD4-positive cells, but will never lead to a complete loss of the cells. This may be indicative of a lower susceptibility to SHIV-induced disease in the monkey population that was used for the second study. Nonetheless, a beneficial effect of the gp120/NefTat/SIV Nef vaccine and the two gp120/Tat vaccines is demonstrable. The number of animals with a % of CD4-positive cells above 20 is 5 for the vaccinated animals, while none of the control animals from the adjuvant group remains above that level.

Analysis of RNA plasma virus loads confirms the relatively low susceptibility of the study animals (FIG. 17). Only 2 of the 6 control animals maintain a high virus load, while the virus disappears from the plasma in the other animals. Thus, a vaccine effect is difficult to demonstrate for the virus load parameter.

Conclusions

Analysis of CD4-positive cells indicates that the vaccine gp120/NefTat+adjuvant (in the presence of SIV Nef) prevents the drop of CD4-positive cells in most vaccinated animals This is a confirmation of the result obtained in the first SHIV study. Due to the lack of susceptibility of the study animals, the virus load parameter could not be used to demonstrate a vaccine effect. Taken together, the combination of gp120 and Tat and Nef HIV antigens provides protection against the pathologic consequences of HIV infection, as evidenced in a SHIV model.

The Tat alone antigens in combination with gp120 also provide some protection from the decline of CD4-positive cells. The effect is less pronounced than with the gp120/NefTat/SIV Nef antigen combination, but it demonstrates that gp120 and Tat are able to mediate some protective efficacy against SHIV-induced disease manifestations.

The second SHIV challenge study was performed with rhesus monkeys from a source completely unrelated to the source of animals from the first study. Both parameters, % of CD4-positive cells and plasma virus load, suggest that the animals in the second study were less susceptible to SHIV-induced disease, and that there was considerably greater variability among the animals. Nonetheless, a beneficial effect on the maintenance of CD4-positive cells of the gp120/NefTat/SIV Nef vaccine was seen with the experimental vaccine containing gp120/NefTat and SIV Nef. This indicates that the vaccine effect was not only repeated in a separate study, but furthermore demonstrated in an unrelated monkey population.

EXAMPLE 15 Generation of PMID Vectors for gp120 and Nef/Tat

Expression vectors were constructed as described below. Endotoxin free plasmid preps were prepared and used to transfect subconfluent 293T cell monolayers in 24 well tissue culture plates with 1 Î¼g of DNA using Lipofectamine 2000. Samples were harvested 24 hours post transfection and examined by Western Blot to assess expression levels. (FIGS. 18 and 19)

Codon optimisation of gp120 resulted in a substantial increase of REV independent expression.

Generation of Plasmids