TECHNICAL FIELD 0001 The present invention relates to a preventive or therapeutic agent for various diseases, which shows a pharmacological action to various cells in a living body, either by activating a peroxisome proliferator-activated receptor or (hereinafter referred to as PPAR or ) as an intranuclear transcription factor; or by controlling the production of a tumor necrosis factor (hereinafter referred to as TNF).

BACKGROUND ART 0002 Diabetes patients are increasing owing to a recent change in customs of living; and the number of patients in Japan is said to be about 7 millions and, when persons thought to be contacting diabetes are included, be 13 millions or more according to the recent report by the diabetes survey group of the Welfare Ministry, about 10% of the Japanese people of 40 years or older are suffering from diabetes. Progress in Diabetic Medicine 1996 (Vol. 30), Shindan-To-Chiryo Sha, Tokyo, p25, 1996. The above trend does not change over the whole world, and the countermeasure therefor is an urgent social task in view of the arrival of future advanced-age society. 0003 The state of diabetes is said to be a state of persistent hyperglycemia caused by absolute or relative shortage of insulin action. This persistent hyperglycemia causes various chronic complications such as renal failure, retinopathy, neuropathy and the like, making the morbid states based on the diabetes complicated and serious (Diabetes Mellitus Metabolism, Vol. 36, Suppl. 1, p22, 1987). As a countermeasure therefor, it is important to develop an agent which improves glycometabolism and inhibits the state of persistent hyperglycemia. As the morbid state of diabetes, there are two types, that is, an insulin-dependent type (type 1) and an insulin-independent type (type 2). In Japan, diabetes is mostly a type 2 diabetes, that is, an insulin-independent diabetes. As the cause of the type 2 diabetes, insulin resistance and insulin secretion insufficiency are known; and investigation on the therapeutic agent for the type 2 diabetes is being made based on these two causes. 0004 For the insulin secretion insufficiency, there have been widely used an insulin treatment and long-known sulfonyl urea (SU) agents such as Tolbutamide, Acetohexamide, Glibenclamide and the like (Oral Hypoglycemic Agents, N. Engl. J. Meg., Vol. 321, p1231, 1989). The SU agents have a strong action for blood sugar reduction but have a risk of hypoglycemia as a serious side effect (Diabetic Med., Vol. 5, p315, 1988); therefore, they need be used with care. Further, the long-term use of the SU agents has problems such as promotion of obesity (Curr. Opin. Nephrol. Hypertens., Vol. 1, p291, 1992), secondary vitiation and the like. 0005 For the insulin resistance, there have heretofore been used biguanide agents such as Fenformin, Metformin and the like. These biguanide agents have, for example, problems of insufficiency in blood sugar-reducing action and tendency of inducing serious lactose-acidosis (Diabetic Med., Vol. 5, p315, 1988; Practice, Vol. 13, p331, 1996), and are considered to be agents which need be treated with care in clinical use. 0006 In order to solve these problems, there have been clinically applied, in recent years, several agents having a thiazolidinedione skeleton, as a new agent for ameliorating insulin resistance (agents such as Troglitazone, Pioglitazone and the like; JP-A-55-22636, JP-A-60-51189, JP-A-6-157522, etc.); besides the above thiazolidinedione type agents, there are being developed isoxazole ring-containing compounds (WO 95/18125), phenylpropionic acid derivatives (WO 93/21166, WO 96/04260, JP-A-11-158144), malonic acid derivatives (JP-A-9-323982), tyrosine derivatives (JP-A-8-325263), etc. These agents, however, are not sufficiently satisfactory in action, and are anxieties in their uses such as toxicity to kidney, side effects to circulating system, etc. and the like (Lancet., Vol. 350, p1748, 1997). 0007 In addition, in recent years, a tumor necrosis factor (TNF) produced by lipocytes, a free fatty acid or neutral fat in blood, etc. have come to be regarded as important as a substance causing insulin resistance (Prostaglandins Leukotriens Essent. Fatty Acid, Vol. 53, p385, 1995); and a thought is developing that it is necessary to develop a more efficient agent for ameliorating insulin resistance based on a wider mechanism. 0008 Heretofore, however, there has been no technique for simply determining the TNF produced by lipocytes; and there has been known substantially no compound which can efficiently inhibit the production of TNF from lipocytes. 0009 Meanwhile, up to now, PPAR, PPAR (), PPAR, etc. are known as sub types of PPAR (Latruffe N. and Vamecq J., Biochemie, Vol. 79, p81, 1997). In recent years, the agent for activating PPAR has come to be considered to promote mainly lipid metabolism and show a blood lipid-reducing action. For example, Fibrate type agents (e.g. Clofibrate and Bezafibrate) for curing hyperlipemia, which are already being applied clinically, have a PPAR-activating action. Although this action is weak, this action is considered to be one of the mechanisms for expression of pharmacological action. Also, it is considered that part of the blood sugar-reducing action of the above-mentioned agents improving insulin resistance (e.g. thiazolidine type agents) might be derived from the PPAR -activating action. Thus, it is becoming clear in recent years that PPAR has an important role for glycometabolism or lipid metabolism in a living body. 0010 Further, both PPAR and PPAR have come to be known to have an influence on a wide range of phlocytes in addition to their known influence on lipid metabolism and glycometabolism (Igaku No Ayumi, Vol. 190, No. 10, p928, 1999); and their application to a new anti-inflammatory agent based on those novel mechanisms is expected. 0011 Thus, PPAR or -activating agents are expected as a preventive or therapeutic agent for many diseases mentioned previously. However, the agents known heretofore show, for example, no sufficient activation regardless of whether they are used singly to PPAR sub types (PPAR and PPAR); therefore, they have had inconveniences, for example, in that they are not fully effective or are effective only to limited patients. Further, they have many problems as a drug, in toxicity, phamacokinetics of drug, etc.; and it is desired to develop a preventive or therapeutic agent for the above-mentioned diseases, which is more effective and can be applied to wider patients. 0012 Meanwhile, some quinoline derivatives are already being clinically applied or clinically developed as a medicine. Examples of such a medicine being clinically applied include Saquinavir methanesulfonate (Roche) as an antiviral agent, mefloquine hydrochloride (Roche) as an antimalarial agent, and sodium salt of Montelukast (Merck) as an antiallergic agent. However, no preventive or therapeutic agent has heretofore been known which can activate PPAR or or inhibit the production of TNF produced by lipocytes and which is useful to diabetes or its complications, hyperlipemia, arteriosclerosis, rheumatoid arthritis, osteoarthritis, asthma, bronchitis, allergic diseases, inflammatory splanchnopathy, ulcerative colitis, Crohn's disease, sepsis, septic shock, Kepla tuberculosis, multiple sclerosis, ischemic angiopathies such as DIC and the like, cerebral malaria, hepatitis, cancer, autoimmune disease, cachexia which becomes a problem in cancer or viral diseases (e.g. AIDS), etc. Each of the quinoline derivatives shown in the claims of the present invention is unknown yet and novel.

DISCLOSURE OF THE INVENTION 0013 The object of the present invention is to provide quinoline derivatives which activate PPAR or (an intranuclear transcription factor) or suppress the production of TNF and thereby becomes a preventive or therapeutic agent against diabetes or its complications, hyperlipemia, arteriosclerosis, rheumatoid arthritis, osteoarthritis, asthma, bronchitis, allergic diseases, inflammatory splanchnopathy, ulcerative colitis, Crohn's disease, sepsis, septic shock, Kepla tuberculosis, multiple sclerosis, ischemic angiopathies such as DIC and the like, cerebral malaria, hepatitis, cancer, autoimmune disease, cachexia which becomes a problem in cancer or viral diseases (e.g. AIDS), etc. 0014 In order to achieve the above object, the present inventors made an effort to find out a substance which shows, in various cell levels, a PPAR or -activating action, a TNF production-inhibiting action in lipocytes or a glucose consumption-promoting activity and, in model animal levels of morbid states, a blood sugar-reducing action, a lipid-reducing action, etc. As a result, the present inventors found out the following matters concerning the group of the compounds represented by the formulas (1) or (2) of the present invention: 0015 They have a strong action for PPAR or activation, a strong action for inhibition of TNF production, or a strong activity for promotion of glucose consumption in various cells; and exhibit a strong action for blood sugar reduction or a strong action for lipid reduction to various animals. They have low toxicity. They are well absorbed when administered orally. They are therefore a very useful medicine. 0016 These findings have led to the completion of the present invention. 0017 The quinoline derivatives according to the present invention are the compounds represented by the following formula (1): 2

0018 (wherein R1, R2, R3, R4, R5, R6 and R11 are each independently a hydrogen atom, a lower alkyl group of 1 to 4 carbon atoms, a halogen atom, a hydroxyl gorup, an alkyloxy group of 1 to 10 carbon atoms, a nitro group, an optionally substituted phenyl group, an amino group which may be substituted with a lower alkyl group of 1 to 4 carbon atoms, a cyano group, a carboxyl group, a lower alkyloxycarbonyl group of 1 to 4 carbon atoms, an aminocarbonyl group which may be substituted with a lower alkyl group of 1 to 4 carbon atoms, or a trifluoromethyl group; R7 and R8 are a hydrogen atom or a lower alkyl group of 1 to 4 carbon atoms and may directly bond to each other to form a carbon-to-carbon double bond; R9 is a hydroxyl gorup, an alkyloxy group of 1 to 10 carbon atoms, an optionally substituted phenyloxy group, a thiol group, an alkylthiol group of 1 to 10 carbon atoms, an optionally substituted phenylthiol group, a lower alkylcarbonyl group of 1 to 4 carbon atoms, an optionally substituted benzoyl group, a lower alkyloxycarbonyl group of 1 to 4 carbon atoms, an aminocarbonyl group which may be substituted with a lower alkyl group of 1 to 4 carbon atoms, or a carboxyl group; R10 is a hydroxyl group, a lower alkyl group of 1 to 4 carbon atoms, a lower alkyloxy group of 1 to 4 carbon atoms, an optionally substituted phenyloxy group or an amino group which may be substituted with a lower alkyl group of 1 to 4 carbon atoms; and n is an integer of 1 to 4). 0019 A preferred form of this quinoline derivative is a compound represented by the following formula (2): 3

0020 (wherein R1, R2, R3, R4, R5, R6, R7, R8 and R11 have the same definitions as in claim 1; and R12 is a lower alkyl group of 1 to 4 carbon atoms or an optionally substituted phenyl group). 0021 Other preferred form of the above quinoline derivative is a compound represented by the following formula (3): 4

0022 The pharmacologically acceptable salts of these quinoline derivatives are as well included in the present invention. 0023 By using these quinoline derivatives and their pharmacologically acceptable salts as an active ingredient, there can be provided various medical compositions such as antagonist for peroxisome proliferator-activated receptors or which is an intranuclear transcription factor, inhibitor for production of tumor necrosis factor , preventive or therapeutic agent for diabetes, preventive or therapeutic agent for hyperlipemia, preventive or therapeutic agent for arterioscrelosis, and the like.

BEST MODE FOR CARRYING OUT THE INVENTION 0024 The present invention is described in more detail below. 0025 In the above formula (1) or (2), the lower alkyl group of 1 to 4 carbon atoms refers to methyl group, ethyl group, propyl group, isopropyl group, cyclopropyl group, butyl group, isobutyl group, tert-butyl group, cyclobutyl group or the like. 0026 The halogen atom refers to fluorine atom, chlorine atom, bromine atom, iodine atom or the like. 0027 The alkyloxy group of 1 to 10 carbon atoms refers to a straight chain, branched chain or cyclic alkyloxy group such as methoxy group, ethoxy group, propoxy group, isopropoxy group, cyclopropoxy group, butoxy group, isobutoxy group, tert-butoxy group, cyclobutoxy group, pentyloxy group, hexyloxy group, heptyloxy group, octyloxy group, nonyloxy group, decyloxy group or the like. 0028 The lower alkylcarbonyl group of 1 to 4 carbon atoms refers to acetyl group, propionyl group, butyryl group, isobutyryl group, valeryl group or the like. 0029 The lower alkyloxycarbonyl group of 1 to 4 carbon atoms refers to methoxycarbonyl group, ethoxycarbonyl group, propoxycarbonyl group, isopropoxycarbonyl group, cyclopropoxycarbonyl group, butoxycarbonyl group, isobutoxycarbonyl group, tert-butoxycarbonyl group, cyclobutoxycarbonyl group or the like. 0030 The pharmacologically acceptable salt refers to a salt of a base of a metal such as sodium, potassium, calcium or the like; a salt of an organic base such as pyridine, triethylamine, piperazine or the like; a salt of an inorganic acid such as hydrochloric acid, sulfuric acid, nitric acid or the like; or a salt of an organic acid such as acetic acid, fumaric acid, tartaric acid, malonic acid or the like. 0031 The compound of the present invention includes those compounds having asymetric carbon atoms and being in the form of optical isomers. Therefore, all of these compounds are included in the present invention. Further, the present compound includes those compounds being in the form of geometrical isomers based on carbon-to-carbon unsaturated bonds. Therefore, all of these compounds are included in the present invention. 0032 Description is made below on the synthesis processes of the compound of the present invention. 0033 Synthesis Process 10034 A compound represented by the formula (1) can be synthesized by using a quinoline derivative represented by the above formula (3) and a phenol derivative represented by the following formula (4). Examples of the synthesis are shown in the following reaction schemes (1) and (2). 5

0035 (In the above reaction schemes, R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11 and n have the same definitions as given above; and X is a halogen atom or a substituted sulfonyloxy group.) 0036 I The Reaction Scheme (1) is Explained. 0037 A quinoline alcohol derivative represented by the formula (3), obtained by a known or substantially known process is reacted with a phenol derivative represented by the formula (4), obtained by a known or substantially known process, in the presence of an alkyl or aryl phosphine or an azodicarboxylic acid derivative, whereby a compound represented by the formula (1) can be obtained. There is no particular restriction as to the usable alkyl or aryl phosphine, but it is exemplified by triphenylphosphine and tributylphosphine. 0038 There is also no particular restriction as to the usable azodicarboxylic acid, but it is exemplified by diethylazodicarboxylic acid and diisopropylazodicarboxylic acid. There is no particular restriction as to the usable solvent, but it is exemplified by dichloromethane, chloroform, dichloroethane, tetrahydrofuran (hereinafter referred to as THF), dioxane, dimethylformamide (hereinafter referred to as DMF), dimethyl sulfoxide (hereinafter referred to as DMSO) and toluene. The reaction can be carried out in a temperature range of 100 C. to the boiling point of the solvent used, preferably a temperature range of 0 C. to the boiling point of the solvent. 0039 II The Reaction Scheme (2) is Explained. 0040 A quinoline alcohol derivative represented by the formula (3) is converted into a halide represented by the formula (5) using a generally known agent for halogenation of alcohol or into a sulfonic acid ester compound represented by the formula (5) using a generally known agent for sulfonic acid esterification of alcohol; then, the compound of the formula (5) is reacted with a phenol derivative represented by the formula (4) under a basic condition; thereby, a compound represented by the formula (1) can be obtained. 0041 There is no particular restriction as to the agent for halogenation of alcohol, and it is exemplified by hydrochloric acid, hydrobromic acid, thionyl chloride, sulfuryl chloride, phosphorus trichloride, phosphorus pentachloride, phosphorus oxychloride, thionyl bromide, phosphorus tribromide, methanesulfonyl chloride, and a mixed agent between triphenylphosphine and iodine, carbon tetrabromide, carbon tetrachloride or N-halogenated succinimide. 0042 There is no particular restriction as to the usable agent for sulfonic acid esterification of alcohol. It is exemplified by methane sulfonic acid chloride, p-toluenesulfonic acid chloride and trifluoromethanesulfonic acid anhydride. 0043 There is no particular restriction as to the base usable in the present reaction. It is exemplified by alkali or alkaline earth metals such as sodium, potassium, magnesium and the like; metal alkoxides such as sodium methoxide, sodium ethoxide, potassium butoxide and the like; inorganic bases such as sodium hydroxide, potassium hydroxide, sodium carbonate, potassium carbonate, cesium carbonate and the like; alkali metal amides such as lithium diisopropylamide and the like; and organic bases such as pyridine, triethylamine, 1,8-diazabicyclo-7-undecene (hereinafter referred to as DBU) and the like. 0044 There is no particular restriction as to the usable solvent. It is exemplified by protic solvents such as water, methanol, ethanol, acetic acid and the like; and aprotic solvents such as dichloromethane, chloroform, dichloroethane, THF, dioxane, DMF, DMSO, toluene and the like. 0045 The reaction can be carried out in a temperature range of 100 C. to the boiling point of the solvent used, preferably in a temperature range of 20 C. to the boiling point of the solvent. 0046 Synthesis Process 20047 Alternatively, the compound represented by the formula (1) can also be synthesized by treating either a quinoline derivative represented by the formula (3), or a quinoline derivative represented by the formula (5) which can be obtained from the compound of the formula (3) by the method shown in the synthesis process 1, with a phenol derivative represented by the formula (6) in the same manner as in the ether linkage formation of the synthesis process 1, to obtain an aldehyde or ketone derivative represented by the formula (7) and then reacting the derivative of the formula (7) with a compound represented by the formula (8). An example of the synthesis process 2 is shown in the following reaction scheme (3). 7

0048 (In the above reaction scheme, R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11, X and n have the same definitions as given above; R12 is a hydrogen atom or a lower alkyl group of 1 to 4 carbon atoms; and R13 a hydrogen atom or a lower alkyl group of 1 to 4 carbon atoms.) 0049 The reaction scheme (3) is explained in more detail. 0050 An aldehyde or ketone represented by the formula (7) is subjected to a dehydration and condensation reaction under a basic or acidic condition; thereby, an unsaturated derivative included in the formula (3) can be synthesized. 0051 There is no particular restriction as to the base usable in the present synthesis. It is exemplified by alkali or alkaline earth metals such as sodium, potassium, magnesium and the like; metal alkoxides such as sodium methoxide, sodium ethoxide, potassium butoxide and the like; inorganic bases such as sodium hydroxide, potassium hydroxide, sodium carbonate, potassium carbonate, cesium carbonate and the like; alkali metal amides such as lithium diisopropylamide and the like; organic bases such as pyridine, piperidine, pyrrolidine, triethylamine, DBU and the like; and salts between such an organic base and acetic acid, sulfonic acid or the like. 0052 There is no particular restriction, either, as to the usable acid. It is exemplified by inorganic acids such as hydrochloric acid, sulfuric acid, nitric acid and the like; organic protic acids such as acetic acid, methanesulfonic acid, p-toluenesulfonic acid, camphorsulfonic acid, trifluoroacetic acid and the like; and Lewis acids such as boron trifluoride and the like. 0053 There is no particular restriction as to the usable solvent. It is exemplified by protic solvents such as water, methanol, ethanol, acetic acid and the like; and aprotic solvents such as dichloromethane, chloroform, dichloroethane, THF, dioxane, DMF, DMSO, toluene and the like. 0054 The reaction can be carried out in a temperature range of 100 C. to the boiling point of the solvent used. 0055 Examples of the compounds included in the formula (1) or (2) are shown below. However, the compound of the present invention is not restricted thereto. 0056 (1) 2-Hydroxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0057 (2) 2-Methoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0058 (3) 2-Ethoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0059 (4) 2-Propoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0060 (5) 2-Tert-butoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0061 (6) 2-Octyloxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0062 (7) 2-Decyloxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0063 (8) 2-Phenoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0064 (9) 2-(4-Isopropxy)phenoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0065 (10) 2-(4-Chlorophenoxy)-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0066 (11) 2-Mercapto-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0067 (12) 2-Ethylthio-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0068 (13) 2-Decylthio-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0069 (14) 2-Phenylthio-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0070 (15) 2-(4-Isopropoxy)phenylthio-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0071 (16) 2-(4-Chlorophenylthio)-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid 0072 (17) 3-Oxo-2-4-(quinoline-3-yl)methyloxyphenylmethylbutanoic acid 0073 (18) 3-Oxo-2-4-(quinoline-3-yl)methyloxyphenylmethylpentanoic acid 0074 (19) 3-Oxo-2-4-(quinoline-3-yl)methyloxyphenylmethylheptanoic acid 0075 (20) 3-Oxo-3-phenyl-2-4-(quinoline-3-yl)methyloxyphenylmethylheptanoic acid 0076 (21) 3-Oxo-3-(4-bromophenyl)-2-4-(quinoline-3-yl)methyloxyphenylmethylheptanoic acid 0077 (22) 3-Oxo-3-(2-ethylphenyl)-2-4-(quinoline-3-yl)methyloxyphenylmethylheptanoic acid 0078 (23) Monomethyl4-(quinoline-3-yl)methyloxyphenylmethylmalonate 0079 (24) Monoethyl4-(quinoline-3-yl)methyloxyphenylmethylmalonate 0080 (25) Monobutyl4-(quinoline-3-yl)methyloxyphenylmethylmalonate 0081 (26) 4-(Quinoline-3-yl)methyloxyphenylmethylmalonic acid mono-N-methylamide 0082 (27) 4-(Quinoline-3-yl)methyloxyphenylmethylmalonic acid mono-N,N-dibutylamide 0083 (28) 2-Ethoxy-3-4-(quinoline-2-yl)methyloxyphenylpropanoic acid 0084 (29) 2-Ethoxy-3-4-(quinoline-4-yl)methyloxyphenylpropanoic acid 0085 (30) 2-Ethoxy-3-4-(quinoline-5-yl)methyloxyphenylpropanoic acid 0086 (31) 2-Ethoxy-3-4-(quinoline-5-yl)methyloxyphenylpropanoic acid 0087 (32) 2-Ethoxy-3-4-(quinoline-6-yl)methyloxyphenylpropanoic acid 0088 (33) 2-Ethoxy-3-4-(quinoline-7-yl)methyloxyphenylpropanoic acid 0089 (34) 2-Ethoxy-3-4-(quinoline-8-yl)methyloxyphenylpropanoic acid 0090 (35) 2-Ethoxy-3-4-(quinoline-3-yl)ethyloxyphenylpropanoic acid 0091 (36) 2-Ethoxy-3-4-(quinoline-3-yl)butyloxyphenylpropanoic acid 0092 (37) 2-Ethoxy-2-methyl-3-4-(quinoline-3-yl)ethyloxyphenylpropanoic acid 0093 (38) 2-Ethoxy-2-butyl-3-4-(quinoline-3-yl)ethyloxyphenylpropanoic acid 0094 (39) 2-Ethoxy-3-4-(quinoline-3-yl)ethyloxyphenylpropenoic acid 0095 (40) 3-4-(Quinoline-3-yl)methyloxyphenylmethyl-2,4-dioxopentane 0096 (41) 5-4-(Quinoline-3-yl)methyloxyphenylmethyl-4,6-dioxodecane 0097 (42) Methyl 2-ethoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoate 0098 (43) Ethyl 2-ethoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoate 0099 (44) Butyl 2-ethoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoate 0100 (45) Phenyl 2-ethoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoate 0101 (46) 4-Iodophenyl 2-ethoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoate 0102 (47) 2-Ethoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid amide 0103 (48) 2-Ethoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid N-methylamide 0104 (49) 2-Ethoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid N-butylamide 0105 (50) 2-Ethoxy-3-4-(quinoline-3-yl)methyloxyphenylpropanoic acid N,N-dimethylamide 0106 (51) 2-Ethoxy-3-3-(quinoline-3-yl)methyloxyphenylpropanoic acid 0107 (52) 2-Ethoxy-3-2-(quinoline-3-yl)methyloxyphenylpropanoic acid 0108 (53) 2-Ethoxy-3-4-methyl-3-(quinoline-3-yl)methyloxyphenylpropanoic acid 0109 (54) 2-Ethoxy-3-4-methyloxy-3-(quinoline-3-yl)methyloxyphenylpropanoic acid 0110 (55) 2-Ethoxy-3-4-chloro-3-(quinoline-3-yl)methyloxyphenylpropanoic acid 0111 (56) 2-Ethoxy-3-4-(4-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid 0112 (57) 2-Ethoxy-3-4-(4,6-dimethoxyquinoline-3-yl)methyloxyphenylpropanoic acid 0113 (58) 2-Ethoxy-3-4-(4,6,7-trimethoxyquinoline-3-yl)methyloxyphenylpropanoic acid 0114 (59) 2-Ethoxy-3-4-(4-ethoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid 0115 (60) 2-Ethoxy-3-4-(4-propoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid 0116 (61) 2-Ethoxy-3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid 0117 (62) 2-Ethoxy-3-4-(4-heptyloxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid 0118 (63) 2-Ethoxy-3-4-(4-octyloxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid 0119 (64) 2-Ethoxy-3-4-(4-isopropoxy-7-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid 0120 (65) 2-Ethoxy-3-4-(4-isopropoxy-6,7-dimethoxyquinoline-3-yl)methyloxyphenylpropanoic acid 0121 (66) 2-Ethoxy-3-4-(4-isopropoxy-6-methylquinoline-3-yl)methyloxyphenylpropanoic acid 0122 (67) 2-Ethoxy-3-4-(4-isopropoxy-6-ethylquinoline-3-yl)methyloxyphenylpropanoic acid 0123 (68) 2-Ethoxy-3-4-(4-decyloxy-6-methylquinoline-3-yl)methyloxyphenylpropanoic acid 0124 (69) 2-Ethoxy-3-4-(4-isopropoxy-8-butylquinoline-3-yl)methyloxyphenylpropanoic acid 0125 (70) 2-Ethoxy-3-4-(4-isopropoxy-5,6-dimethylquinoline-3-yl)methyloxyphenylpropanoic acid 0126 (71) 2-Ethoxy-3-4-(4-isopropoxy-5,7-dimethylquinoline-3-yl)methyloxyphenylpropanoic acid 0127 (72) 2-Ethoxy-3-4-(4-isopropoxy-2-chloroquinoline-3-yl)methyloxyphenylpropanoic acid 0128 (73) 2-Ethoxy-3-4-(4-isopropoxy-5-chloroquinoline-3-yl)methyloxyphenylpropanoic acid 0129 (74) 2-Ethoxy-3-4-(4-isopropoxy-6-chloroquinoline-3-yl)methyloxyphenylpropanoic acid 0130 (75) 2-Ethoxy-3-4-(4-isopropoxy-7-chloroquinoline-3-yl)methyloxyphenylpropanoic acid 0131 (76) 2-Ethoxy-3-4-(4-isopropoxy-8-chloroquinoline-3-yl)methyloxyphenylpropanoic acid 0132 (77) 2-Ethoxy-3-4-(4-isopropoxy-2-bromoquinoline-3-yl)methyloxyphenylpropanoic acid 0133 (78) 2-Ethoxy-3-4-(4-isopropoxy-6-bromoquinoline-3-yl)methyloxyphenylpropanoic acid 0134 (79) 2-Ethoxy-3-4-(4-isopropoxy-8-bromoquinoline-3-yl)methyloxyphenylpropanoic acid 0135 (80) 2-Ethoxy-3-4-(4-isopropoxy-2-fluoroquinoline-3-yl)methyloxyphenylpropanoic acid 0136 (81) 2-Ethoxy-3-4-(4-isopropoxy-5-fluoroquinoline-3-yl)methyloxyphenylpropanoic acid 0137 (82) 2-Ethoxy-3-4-(4-isopropoxy-8-fluoroquinoline-3-yl)methyloxyphenylpropanoic acid 0138 (83) 2-Ethoxy-3-4-(4-isopropoxy-8-iodoquinoline-3-yl)methyloxyphenylpropanoic acid 0139 (84) 2-Ethoxy-3-4-(4-isopropoxy-2-trifluoromethylquinoline-3-yl)methyloxyphenylpropanoic acid 0140 (85) 2-Ethoxy-3-4-(4-isopropoxy-7-trifluoromethylquinoline-3-yl)methyloxyphenylpropanoic acid 0141 (86) 2-Ethoxy-3-4-(4-isopropoxy-8-trifluoromethylquinoline-3-yl)methyloxyphenylpropanoic acid 0142 (87) 2-Ethoxy-3-4-(4-isopropoxy-2-hydroxyquinoline-3-yl)methyloxyphenylpropanoic acid 0143 (88) 2-Ethoxy-3-4-(4-isopropoxy-2-acetamidoquinoline-3-yl)methyloxyphenylpropanoic acid 0144 (89) 2-Ethoxy-3-4-(4-isopropoxy-5-nitroquinoline-3-yl)methyloxyphenylpropanoic acid 0145 (90) 2-Ethoxy-3-4-(4-isopropoxy-5-cyanoquinoline-3-yl)methyloxyphenylpropanoic acid 0146 (91) 2-Ethoxy-3-4-(4-isopropoxy-8-aminoquinoline-3-yl)methyloxyphenylpropanoic acid 0147 (92) 2-Ethoxy-3-4-(4-isopropoxy-8-N-ethylaminoquinoline-3-yl)methyloxyphenylpropanoic acid 0148 (93) 2-Ethoxy-3-4-(4-isopropoxy-8-carboxyquinoline-3-yl)methyloxyphenylpropanoic acid 0149 (94) 2-Ethoxy-3-4-(4-isopropoxy-8-ethoxycarbonylquinoline-3-yl)methyloxyphenylpropanoic acid 0150 (95) 2-Ethoxy-3-4-(4-isopropoxy-8-phenylquinoline-3-yl)methyloxyphenylpropanoic acid 0151 (96) 2-Ethoxy-3-4-(2-phenylquinoline-3-yl)methyloxyphenylpropanoic acid 0152 (97) 2-Ethoxy-3-4-(2-phenylquinoline-4-yl)methyloxyphenylpropanoic acid 0153 (98) 2-Ethoxy-3-4-(2-methoxyquinoline-4-yl)methyloxyphenylpropanoic acid 0154 (99) 2-Ethoxy-3-4-(2-methoxyquinoline-2-yl)methyloxyphenylpropanoic acid 0155 (100) Methyl 2-ethoxy-3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoate 0156 (101) Ethyl 2-ethoxy-3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoate 0157 (102) 2-Ethoxy-3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid amide 0158 (103) 2-Ethoxy-3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid N-ethylamide 0159 (104) 2-Ethoxy-3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid N-butylamide 0160 (105) 2-Ethoxy-3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid N,N-diethylamide 0161 (106) 3-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-phenoxypropanoic acid 0162 (107) 3-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-(4-chlorophenoxy)propanoic acid 0163 (108) 3-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-phenylthiopropanoic acid 0164 (109) 3-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-(4-chlorophenylthio)propanoic acid 0165 (110) 3-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-phenoxypropenoic acid 0166 (111) 3-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-(4-chlorophenoxy)propenoic acid 0167 (112) 3-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-phenylthiopropenoic acid 0168 (113) 3-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-(4-chlorophenylthio)propenoic acid 0169 (114) 2-Ethoxy-3-3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid 0170 (115) 2-Ethoxy-3-2-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid 0171 (116) 2-Ethoxy-3-3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxy-2-methylphenylpropanoic acid 0172 (117) 2-Ethoxy-3-3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxy-5-chlorophenylpropanoic acid 0173 (118) 2-Ethoxy-3-3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxy-4-methoxyhenylpropanoic acid 0174 (119) Monomethyl4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonate 0175 (120) Dimethyl4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonate 0176 (121) Monoethyl4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonate 0177 (122) Diethyl4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonate 0178 (123) Dipropyl4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonate 0179 (124) Dibutyl4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonate 0180 (125) Monomethyl2-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonate 0181 (126) Dimethyl3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonate 0182 (127) Monoethyl3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonate 0183 (128) Diethyl3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonate 0184 (129) Diethyl3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxy-4-methoxyphenylmethylmalonate 0185 (130) Diethyl3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxy-6-methylphenylmethylmalonate 0186 (131) 4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonic acid diamide 0187 (132) 4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonic acid N,N-dimethyldiamide 0188 (133) 2-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3-oxobutanoic acid 0189 (134) Methyl 2-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3-oxobutanoate 0190 (135) Ethyl 2-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3-oxobutanoate 0191 (136) 2-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3-oxopentanoic acid 0192 (137) Methyl 2-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3-oxopentanoate 0193 (138) Ethyl 2-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3-oxopentanoate 0194 (139) Ethyl 2-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3-oxoheptanoic acid 0195 (140) 2-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3-oxobutanoic acid amide 0196 (141) 2-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3-oxobutanoic acid N-methylamide 0197 (142) 2-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3-oxobutanoic acid N,N-dibutylamide 0198 (143) 2-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3-oxobutanoic acid amide 0199 (144) 2-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylene-3-oxobutanoic acid N-methylamide 0200 (145) 2-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylene-3-oxobutanoic acid N,N-dibutylamide 0201 (146) 3-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-2,4-dioxopentane 0202 (147) 3-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylene-2,4-dioxopentane 0203 (148) 4-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3,5-dioxoheptane 0204 (149) 4-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylene-3,5-dioxoheptane 0205 (150) 5-4-(4-Isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylene-4,6-dioxodecane 0206 Some of the above compounds have asymetric carbon atoms and are in the form of optical isomers. Therefore, all of these isomers are included in the scope of the present invention. 0207 Next, the compound of the present invention, when used as a medicine, can be administered orally or parenterally. The dose varies depending upon the disease condition, age, sex, etc. of a patient to which the compound is to be administered. However, the compound can be administered in a total amount of 1 to 1000 mg per adult, in one time or a plurality of times. In oral administration, the compound can be administered in the form of tablet(s), granule(s), powder, suspension, capsule(s), syrup or the like. 0208 When the compound is made into, for example, tablets, it is possible to use, as an adsorbent, crystalline cellulose, light anhydrous silicic acid or the like; as an excipient, corn starch, lactose, calcium phosphate, magnesium stearate or the like; and, as necessary, a binder, a humectant, a lubricant, etc. 0209 In parenteral administration, the present compound can be administered in the form of intravenous injection, subcutaneous injection, intramuscular injection, suppository, percutaneous agent or the like. When the compound is made into, for example, an injection, the compound can be used as an aqueous solution obtained by subjecting the compound to isotonization, sterilization, etc., or as an aqueous suspension obtained by using cottonseed oil, corn oil, olive oil or the like, or as an emulsion obtained by using a surfactant such as HCO-60 or the like. 0210 The present invention is described in more detail below by way of Examples, Reference Examples and Test Examples. However, the present invention is in no way restricted by them.

EXAMPLE 1 0211 Synthesis of ethyl 2-ethoxy-3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoate: Exemplary Compound (101) 8

0212 In methylene chloride (60 ml) were dissolved 4-isopropoxy-6-methoxyquinoline-3-methanol (1.98 g, 8 mmol) synthesized in Reference Example 4 and ethyl 2-ethoxy-3-(4-hydroxyphenyl)propanoate (1.91 g, 8 mmol). Thereto were added, at room temperature, triphenylphosphine (2.52 g, 9.6 mmol) and diethyl azodicarboxylic acid (4.18 g, 9.6 mmol), followed by stirring in that state for 2 hours. The reaction mixture was diluted with chloroform, followed by washing with water. The organic layer was dried over anhydrous magnesium sulfate and subjected to vacuum concentration. The residue was purified by silica gel column chromatography (equivalent product of Merck C-300: 150 g, ethyl acetate:hexane1:2) to obtain an intended title compound (2.4 g, 64%) as a colorless transparent syrup. 0213 1H-N.M.R. (CDCl3, 270 MHz)d8.82(s, 1H), 7.98(d, 1H, J8.0 Hz), 7.407.30(m, 2H), 7.18 and 6.94(2 d, each 2H, J8.5 Hz), 5.20(s, 2H), 4.58(quintet, 1H, J6.5 Hz), 4.21(q, 2H, J7.3 Hz), 3.96(t, 1H, J7.3 Hz), 3.95(s, 3H), 3.653.55(m, 1H), 3.403.30(m, 1H), 2.95(d, 2H, J7.3 Hz), 1.40(d, 6H, J6.5 Hz), 1.351.15(m, 6H)

EXAMPLE 2 0214 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (61) 9

0215 The ester compound (2.4 g, 5.13 mmol) obtained in Example 1 was dissolved in ethanol (40 ml). Thereto was added, at room temperature, a 2 N aqueous sodium hydroxide solution (3.85 ml, 7.70 mmol), followed by stirring at that temperature for 1 hour. The most part of ethanol was removed from the reaction mixture by vacuum distillation. The residue was dissolved in water (100 ml). The solution was made weakly acidic using 1 N hydrochloric acid, followed by extraction with ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and then subjected to vacuum concentration to obtain a colorless transparent syrup. The residue was subjected to crystallization using a mixed solvent consisting of ethyl acetate and hexane to obtain an intended title compound (2.10 g, 93%) as white crystals. 0216 Melting point: 152 to 154 C. 0217 1H-N.M.R. (CDCl3, 270 MHz)d8.80(s, 1H), 8.07(d, 1H, J9.0 Hz), 7.407.30(m, 2H), 7.22 and 6.92(2 d, each 2H, J9.0 Hz), 5.20(s, 2H), 4.60(quintet, 1H, J6.5 Hz), 4.08(dd, 1H, J4.5, 7.3 Hz), 3.95(s, 3H), 3.753.65(m, 1H), 3.503.40(m, 1H), 3.12(dd, 1H, J4.5, 13.0 Hz), 3.02(dd, 1H, J7.3, 13.0 Hz), 1.42(d, 6H, J6.5 Hz), 1.18(t, 3H, J7.3 Hz)

EXAMPLE 3 0218 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid amide: Exemplary Compound (102) 10

0219 The carboxylic acid compound (150 mg, 0.341 mmol) obtained in Example 2 was dissolved in tetrahydrofuran (10 ml). Thereto was added 1,1-carbonylbisimidazole (110 mg, 0.682 mmol) at room temperature, followed by stirring in that state for 30 minutes. Successively, 28% ammonia water (2 ml) was added, followed by stirring for 30 minutes. The reaction mixture was diluted with water, and extraction of an intended compound was conducted using ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and then subjected to vacuum concentration to obtain a colorless transparent syrup. The residue was subjected to crystallization using a mixed solvent consisting of ethyl acetate and hexane, to obtain an intended title compound (125 mg, 84%) as a white amorphous solid. 0220 1H-N.M.R. (CDCl3, 270 MHz)d8.82(s, 1H), 7.99(d, 1H, J8.8 Hz), 7.397.35(m, 2H), 7.19(d, 2H, J8.8 Hz), 6.93(d, 2H, J8.8 Hz), 6.48 and 5.58(2 bs, each 1H), 5.21(s, 2H), 4.59(quintet, 1H, J6.1 Hz), 3.96(s, 3H), 3.90(dd, 1H, J3.6, 7.6 Hz), 3.533.42(m, 2H), 3.08(dd, 1H, J3.6, 13.7 Hz), 2.90(dd, 1H, J7.6, 13.7 Hz), 1.41(d, 6H, J6.1 Hz), 1.14(t, 3H, J7.1 Hz)

EXAMPLE 4 0221 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid N-butylamide: Exemplary Compound (104) 11

0222 The carboxylic acid compound (150 mg, 0.341 mmol) obtained in Example 2 was dissolved in tetrahydrofuran (10 ml). Thereto was added 1,1-carbonylbisimidazole (110 mg, 0.682 mmol) at room temperature, followed by stirring in that state for 30 minutes. Successively, n-butylamine (150 mg, 2.05 mmol) was added, followed by stirring for 1 hour. The reaction mixture was diluted with water, and extraction of an intended compound was conducted using ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and then subjected to vacuum concentration. The residue was purified by silica gel column chromatography (equivalent product of Merck C-300: 20 g, ethyl acetate:hexane1:1) to obtain an intended title compound (135 mg, 80%) as white crystals. 0223 Melting point: 66 to 68 C. 0224 1H-N.M.R. (CDCl3, 270 MHz)d8.82(s, 1H), 7.98(d, 1H, J8.8 Hz), 7.397.35(m, 2H), 7.17(d, 2H, J8.3 Hz), 6.92(d, 2H, J8.3 Hz), 6.50(t, 1H, J5.9 Hz), 5.21(s, 2H), 4.59(quintet, 1H, J5.8 Hz), 3.96(s, 3H), 3.90(dd, 1H, J3.4, 7.3 Hz), 3.503.41(m, 2H), 3.233.13(m, 2H), 3.09(dd, 1H, J3.4, 14.1 Hz), 2.85(dd, 1H, J7.3, 14.1 Hz), 1.501.35(m, 4H), 1.41(d, 6H, J5.8 Hz), 1.14(t, 3H, J6.8 Hz), 0.91(t, 3H, J6.8 Hz)

EXAMPLE 5 0225 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-5,7-dimethylquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (71) 0226 Reaction 1 Synthesis of ethyl 2-ethoxy-3-4-(4-isopropoxy-5,7-dimethylquinoline-3-yl)methyloxyphenylpropanoate 12

0227 4-Isopropoxy-5,7-dimethylquinoline-3-methanol (756 mg, 3 mmol) synthesized in Reference Example 9 and ethyl 2-ethoxy-3-(4-hydroxyphenyl)propanoate (715 mg, 3 mmol) synthesized in Reference Example 7 were subjected to the same treatment as in Example 1 to obtain an intended title compound (580 mg, 41%) as a colorless transparent syrup. 0228 1H-N.M.R. (CDCl3, 270 MHz)d8.85(s, 1H), 7.70(s, 1H), 7.19 and 6.93(2 d, each 2H, J8.6 Hz), 7.14(s, 1H), 5.16(s, 2H), 4.48(quintet, 1H, J6.3 Hz), 4.16(q, 2H, J7.3 Hz), 3.98(t, 1H, J6.9 Hz), 3.703.55(m, 1H), 3.403.30(m, 1H), 2.96(d, 1H, J6.9 Hz), 2.89 and 2.48(2 s, each 3H), 1.30(d, 6H, J6.3 Hz), 1.21 (t, 3H, J7.3 Hz), 1.17(t, 3H, J7.3 Hz) 0229 Reaction 2 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-5,7-dimethylquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (71) 13

0230 The ester compound (570 mg, 1.22 mmol) synthesized by the reaction 1 of Example 5 was subjected to the same treatment as in Example 2 to obtain an intended title compound (420 mg, 79%) as white crystals. 0231 Melting point144 C. (dec.) 0232 1H-N.M.R. (CDCl3, 270 MHz)d8.82(s, 1H), 8.29(s, 1H), 7.38(s, 1H), 7.22 and 6.89(2 d, each 2H, J8.6 Hz), 5.20(s, 2H), 4.50(quintet, 1H, J6.0 Hz), 4.08(dd, 1H, J4.9, 7.3 Hz), 3.693.58(m, 1H), 3.523.41(m, 1H), 3.08(dd, 1H, J4.9, 13.9 Hz), 3.99(dd, 1H, J7.3, 13.9 Hz), 2.92 and 2.56(2 s, each 3H), 1.47(d, 6H, J6.0 Hz), 1.19(t, 3H, J7.3 Hz)

EXAMPLE 6 0233 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-6-ethylquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (67) 0234 Reaction 1 Synthesis of ethyl 2-ethoxy-3-4-(4-isopropoxy-6-ethylquinoline-3-yl)methyloxyphenylpropanoate 14

0235 4-Isopropoxy-6-ethylquinoline-3-methanol (756 mg, 3 mmol) synthesized in Reference Example 11 and ethyl 2-ethoxy-3-(4-hydroxyphenyl)propanoate (715 mg, 3 mmol) were subjected to the same treatment as in Example 1, to obtain an intended title compound (970 mg, 69%) as a colorless transparent syrup. 0236 1H-N.M.R. (CDCl3, 270 MHz)d8.90(s, 1H), 8.81(d, 1H, J8.6 Hz), 7.89(d, 1H, J1.5 Hz), 7.57(dd, 1H, J1.5, 8.6 Hz), 7.18 and 6.93(2 d, each 2H, J8.6 Hz), 5.21(s, 2H), 4.60(quintet, 1H, J6.3 Hz), 4.16(q, 2H, J7.3 Hz), 3.98(t, 1H, J6.9 Hz), 3.613.58(m, 1H), 3.393.33(m, 1H), 2.96(d, 2H, J6.9 Hz), 2.86(q, 2H, J7.6 Hz), 1.40(d, 6H, J6.3 Hz), 1.35(t, 3H, J7.6 Hz), 1.21(t, 3H, J7.3 Hz), 1.17(t, 3H, J7.3 Hz) 0237 Reaction 2 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-6-ethylquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (67) 15

0238 The ester compound (960 mg, 2.06 mmol) synthesized by the reaction 1 of Example 6 was subjected to the same treatment as in Example 2 to obtain an intended title compound (740 mg, 82%) as white crystals. 0239 Melting point92 to 94 C. 0240 1H-N.M.R. (CDCl3, 270 MHz)d8.92(s, 1H), 8.26(d, 1H, J8.6 Hz), 7.94(d, 1H, J1.3 Hz), 7.67(dd, 1H, J1.3, 8.6 Hz), 7.23 and 6.92(2 d, each 2H, J8.7 Hz), 5.21(s, 2H), 4.75(quintet, 1H, J6.3 Hz), 4.164.06(m, 3H), 3.733.62(m, 1H), 3.513.40(m, 1H), 3.10(dd, 1H, J4.9, 14.1 Hz), 3.01(dd, 1H, J7.2, 14.1 Hz), 2.89(q, 2H, J7.8 Hz), 1.44(d, 6H, J6.3 Hz), 1.35(t, 3H, J7.8 Hz), 1.19(t, 3H, J7.8 Hz)

EXAMPLE 7 0241 Synthesis of 2-ethoxy-3-4-(4-octyloxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (63) 0242 Reaction 1 Synthesis of ethyl 2-ethoxy-3-4-(4-octyloxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoate 16

0243 4-octyloxy-6-methoxyquinoline-3-methanol (952 mg, 3 mmol) synthesized in Reference Example 13 and ethyl 2-ethoxy-3-(4-hydroxyphenyl)propanoate (715 mg, 3 mmol) synthesized in Reference Example 7 were subjected to the same treatment as in Example 1 to obtain an intended title compound (1.07 g, 66%) as a colorless transparent syrup. 0244 1H-N.M.R. (CDCl3, 270 MHz)d8.81(s, 1H), 8.00(d, 1H, J8.6 Hz), 7.457.28(m, 2H), 7.19 and 6.94(2 d, each 2H, J8.6 Hz), 5.21(s, 2H), 4.254.15(m, 4H), 3.98(t, 1H, J6.9 Hz), 3.96(s, 3H), 3.653.55(m, 1H), 3.403.30(m, 1H), 2.97(d, 2H, J6.9 Hz), 1.971.90(m, 2H), 1.601.45(m, 2H), 1.401.15(m, 17H), 0.88(t, 3H, J6.6 Hz) 0245 Reaction 2 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-6-ethylquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (67) 17

0246 The ester compound (1.07 g, 2.00 mmol) synthesized by the reaction 1 of Example 7 was subjected to the same treatment as in Example 2 to obtain a free carboxylic acid. The carboxylic acid was converted into a hydrochloride using 4 N hydrochloric acid and dioxane to obtain an intended title compound (870 mg, 80%) as white crystals. 0247 Melting point142 to 143 C. 0248 1H-N.M.R. (DMSO-d6, 270 MHz)d8.81(s, 1H), 8.00(d, 1H, J8.6 Hz), 7.457.28(m, 2H), 7.19 and 6.94(2 d, each 2H, J8.6 Hz), 5.21(s, 2H), 4.20(t, 2H, J6.9 Hz), 3.98(t, 1H, J6.9 Hz), 3.96(s, 3H), 3.653.55(m, 1H), 3.403.30(m, 1H), 2.97(d, 2H, J6.9 Hz), 1.971.90(m, 2H), 1.601.45(m, 2H), 1.401.15(m, 11H), 0.88(t, 3H, J6.6 Hz)

EXAMPLE 8 0249 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-6,7-dimethoxyquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (65) 0250 Reaction 1 Synthesis of ethyl 2-ethoxy-3-4-(4-isopropoxy-6,7-dimethoxyquinoline-3-yl)methyloxyphenylpropanoate 18

0251 4-propoxy-6,7-dimethoxyquinoline-3-methanol (832 mg, 3 mmol) synthesized in Reference Example 14 and ethyl 2-ethoxy-3-(4-hydroxyphenyl)propanoate (715 mg, 3 mmol) synthesized in Reference Example 7 were subjected to the same treatment as in Example 1 to obtain an intended title compound (760 mg, 51%) as a colorless transparent syrup. 0252 1H-N.M.R. (CDCl3, 270 MHz)d8.77(s, 1H), 7.41(s, 1H), 7.37(s, 1H), 7.19 and 6.94(2 d, each 2H, J8.9 Hz), 5.18(s, 2H), 4.58(quintet, 1H, J6.2 Hz), 4.22(q, 2H, J7.3 Hz), 4.04(s, 6H), 3.98(t, 1H, J6.3 Hz), 3.703.55(m, 1H), 3.453.35(m, 1H), 2.97(d, 2H, J6.3 Hz), 1.40(d, 6H, J6.2 Hz), 1.311.15(m, 6H) 0253 Reaction 2 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-6,7-dimethoxyquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (65) 19

0254 The ester compound (710 mg, 1.43 mmol) synthesized by the reaction 1 of Example 8 was subjected to the same treatment as in Example 2 to obtain a free carboxylic acid. The carboxylic acid was converted into a hydrochloride using 4 N hydrochloric acid and dioxane to obtain an intended title compound (520 mg, 72%) as white crystals. 0255 Melting point155 C. (dec.) 0256 1H-N.M.R. (DMSO-d6, 270 MHz)d8.77(s, 1H), 7.41(s, 1H), 7.37(s, 1H), 7.19 and 6.94(2 d, each 2H, J8.9 Hz), 5.18(s, 2H), 4.58(quintet, 1H, J6.2 Hz), 4.04(s, 6H), 3.98(t, 1H, J6.3 Hz), 3.703.55(m, 1H), 3.453.35(m, 1H), 2.97(d, 2H, J6.3 Hz), 1.40(d, 6H, J6.2 Hz), 1.21(t, 6H, J7.3 Hz)

EXAMPLE 9 0257 Synthesis of 2-ethoxy-3-4-(2-phenylquinoline-4-yl)methyloxyphenylpropanoic acid: Exemplary Compound (97) 0258 Reaction 1 Synthesis of ethyl 2-ethoxy-3-4-(2-phenylquinoline-4-yl)methyloxyphenylpropanoate 20

0259 The alcohol compound (1.92 g) synthesized in Reference Example 15 and the phenol (1.94 g) synthesized in Reference Example 7 were subjected to the same treatment as in Example 1 to obtain an intended title compound (2.47 g, 66%) as a colorless transparent oil. 0260 1H NMR (CDCl3, 270 MHz) d8.23(d, 1H, J7.9 Hz), 8.15(d, 2H, J7.9 Hz), 8.04(s, 1H), 7.99(d, 1H, J8.2 Hz), 7.76(t, 1H,J8.2 Hz), 7.567.46(m, 4H), 7.21(d, 2H, J8.2 Hz), 7.00(d, 2H, J8.2 Hz), 5.58(s, 2H), 4.16(q, 2H, J6.9 Hz), 3.99(t, 1H, J6.9 Hz), 3.673.55(m, 1H), 3.413.30(m, 1H), 2.98(d, 2H, J6.9 Hz), 1.291.13(m, 6H) 0261 Reaction 2 Synthesis of 2-ethoxy-3-4-(2-phenylquinoline-4-yl)methyloxyphenylpropanoic acid: Exemplary compound (97) 21

0262 The ester compound (1.0 g) synthesized by the reaction 1 was subjected to the same treatment as in Example 2 to obtain an intended title compound (1.05 g, 100%) as white crystals. 0263 Melting point142 to 143.5 C. 0264 1H NMR (CDCl3, 270 MHz) d8.24(d, 1H, J8.5 Hz), 8.158.12(m, 2H), 8.03(s, 1H), 7.98(d, 1H, J8.5 Hz), 7.76(t, 1H, J7.1 Hz), 7.607.44(m, 4H), 7.21(d, 2H, J8.5 Hz), 7.00(d, 2H, J8.5 Hz), 5.57(s, 2H), 4.06(dd, 1H, J4.1, 7.6 Hz), 3.643.57(m, 1H), 3.503.42(m, 1H), 3.10(dd, 1H, J4.1, 14.3 Hz), 2.98(dd, 1H, J7.6, 14.3 Hz), 1.17(t, 3H, J7.1 Hz)

EXAMPLE 10 0265 Synthesis of 2-ethoxy-3-4-(quinoline-6-yl)methyloxyphenylpropanoic acid: Exemplary Compound (32) 0266 Reaction 1 Synthesis of ethyl 2-ethoxy-3-4-(quinoline-6-yl)methyloxyphenylpropanoate 22

0267 The alcohol compound (1.31 g) synthesized in Reference Example 16 and the phenol (1.96 g) synthesized in Reference Example 7 were subjected to the same treatment as in Example 1 to obtain an intended title compound (1.47 g, 47%) as a colorless transparent oil. 0268 1H NMR (CDCl3, 270 MHz) d8.92(d, 1H, J4.3 Hz), 8.198.11(m, 2H), 7.88(s, 1H), 7.77(d, 1H, J8.6 Hz), 7.42(dd, 1H, J4.3, 8.2 Hz), 7.18(d, 2H, J8.6 Hz), 6.94(d, 2H, J8.6 Hz), 5.24(s, 2H), 4.16(q, 2H, J7.3 Hz), 3.98(t, 1H, J6.9 Hz), 3.663.55(m, 1H), 3.413.30(m, 1H), 2.96(d, 2H, J6.6 Hz), 1.291.15(m, 6H) 0269 Reaction 2 Synthesis of 2-ethoxy-3-4-(quinoline-6-yl)methyloxyphenylpropanoic acid: Exemplary Compound (32) 23

0270 The ester compound (1.47 g) synthesized by the reaction 1 was subjected to the same treatment as in Example 2 to obtain an intended title compound (1.01 g, 75%) as white crystals. 0271 Melting point96 to 98 C. 0272 1H NMR (CDCl3, 270 MHz) d8.94(d, 1H, J4.4 Hz), 8.23(d, 1H, J8.3 Hz), 8.09(d, 1H, J8.5 Hz), 7.90(s, 1H), 7.77(d, 1H, J8.8 Hz), 7.47(dd, 1H, J4.4, 8.3 Hz), 7.22(d, 2H, J8.8 Hz), 6.93(d, 2H, J8.8 Hz), 5.19(s, 2H), 4.11(dd, 1H, J4.9, 7.1 Hz), 3.713.64(m, 1H), 3.533.46(m, 1H), 3.133.01(m, 2H), 1.21(t, 3H, J7.1 Hz)

EXAMPLE 11 0273 Synthesis of 2-ethoxy-3-4-(4-methoxyquinoline-2-yl)methyloxyphenylpropanoic acid: Exemplary Compound (99) 0274 Reaction 1 Synthesis of ethyl 2-ethoxy-3-4-(4-methoxyquinoline-2-yl)methyloxyphenylpropanoate 24

0275 The alcohol compound (290 mg) synthesized in Reference Example 17 and the phenol (370 mg) synthesized in Reference Example 7 were subjected to the same treatment as in Example 1 to obtain an intended title compound (300 mg, 48%) as a colorless transparent oil. 0276 1H NMR (CDCl3, 270 MHz) d8.18(d, 1H, J8.2 Hz), 7.99(d, 1H, J8.2 Hz), 7.71(t, 1H, J6.6 Hz), 7.50(t, 1H, J6.6 Hz), 7.16(d, 2H, J6.6 Hz), 7.03(s, 1H), 6.96(d, 2H, J6.6 Hz), 5.30(s, 2H), 4.15(q, 2H, J6.9 Hz), 4.04(s, 3H), 3.97(t, 1H, J6.5 Hz), 3.633.57(m, 1H), 3.383.31(m, 1H), 2.95(d, 1H, J6.5 Hz), 1.231.13(m, 6H) 0277 Reaction 2 Synthesis of 2-ethoxy-3-4-(4-methoxyquinoline-2-yl)methyloxyphenylpropanoic acid: Exemplary Compound (99) 25

0278 The ester compound (300 mg) synthesized by the reaction 1 was subjected to the same treatment as in Example 2 to obtain an intended title compound (126 mg, 45%) as white crystals. 0279 Melting point138 to 141 C. 0280 1H NMR (CDCl3, 270 MHz) d8.18(d, 1H, J8.4 Hz), 8.06(d, 1H, J8.4 Hz), 7.72(t, 1H, J8.3 Hz), 7.50(t, 1H, J8.3 Hz), 7.20(d, 2H, J8.6 Hz), 7.03(s, 1H), 6.93(d, 2H, J8.6 Hz), 5.23(s, 2H), 4.10(d, 1H, J6.6 Hz), 4.04(s, 3H), 3.683.60(m, 1H), 3.553.49(m, 1H), 3.133.08(m, 1H), 3.042.98(m, 1H), 1.21(t, 3H, J6.8 Hz)

EXAMPLE 12 0281 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-7-trifluoromethylquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (85) 0282 Reaction 1 Synthesis of ethyl 2-ethoxy-3-4-(4-isopropoxy-7-trifluoromethylquinoline-3-yl)methyloxyphenylpropanoate 26

0283 The alcohol compound (570 mg) synthesized in Reference Example 19 and the phenol (480 mg) synthesized in Reference Example 7 were subjected to the same treatment as in Example 1 to obtain an intended title compound (650 mg, 64%) as a colorless transparent oil. 1H NMR (CDCl3, 270 MHz) d9.07(s, 1H), 8.40(s, 1H), 8.26(d, 1H, J8.9 Hz), 7.72(d, 1H, J8.9 Hz), 7.20(d, 2H, J8.9 Hz), 6.93(d, 2H, J8.9 Hz), 5.24(s, 2H), 4.62(m, 1H), 4.17(q, 2H, J6.9 Hz), 3.98(t, 1H, J6.9 Hz), 3.643.56(m, 1H), 3.393.33(m, 1H), 2.97(d, 2H, J6.6 Hz), 1.41(d, 6H, J6.3 Hz), 1.251.14(m, 6H) 0284 Reaction 2 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-7-trifluoromethylquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (85) 27

0285 The ester compound (626 mg) synthesized by the reaction 1 was subjected to the same treatment as in Example 2 to obtain an intended title compound (450 mg, 76%) as a white amorphous solid. 0286 1H NMR (CDCl3, 270 MHz) d9.06(s, 1H), 8.41(s, 1H), 8.27(d, 1H, J8.8 Hz), 7.73(d, 1H, J8.8 Hz), 7.21(d, 2H, J8.7 Hz), 6.95(d, 2H, J8.7 Hz), 5.24(s, 2H), 4.654.61(m, 1H), 4.09(dd, 1H, J4.4, 7.3 Hz), 3.643.60(m, 1H), 3.533.49(m, 1H), 3.12(dd, 1H, J4.4, 14.1 Hz), 3.00(dd, 1H, JJ7.1, 14.1 Hz), 1.42(d, 6H, J6.1 Hz), 1.20(t, 3H, J7.1 Hz)

EXAMPLE 13 0287 Synthesis of 3-4-(8-chloro-4-isopropoxyquinoline-3-yl)methyloxyphenyl-2-ethoxypropanoic acid: Exemplary Compound (76) 0288 Reaction 1 Synthesis of ethyl 3-4-(8-chloro-4-isopropoxyquinoline-3-yl)methyloxyphenyl-2-ethoxypropanoate 28

0289 The alcohol compound (650 mg, 2.6 mmol) synthesized in Reference Example 20 and the phenol (610 mg, 2.6 mmol) synthesized in Reference Example 7 were subjected to the same treatment as in Example 1 to obtain an intended title compound (890 mg, 73%) as a colorless transparent oil. 0290 1H NMR (CDCl3, 270 MHz) d9.09(1H, s), 8.08(1H, dd, J8.2, 1.4 Hz), 7.84(1H, dd, J7.6, 1.4 Hz), 7.47(1H, dd., J8.2, 7.6 Hz), 7.19(2H, dd, J6.5, 2.4 Hz), 6.92(2H, dd, J6.5, 1.9 Hz), 5.24 (2H, s), 4.67(1H, sept, J6.2 Hz), 4.16(2H, dd, J14, 7.3 Hz), 3.97 (1H, t, J6.8 Hz), 3.59(1H, dd, J14, 7.0 Hz), 3.37(1H, dd., J14, 7.0 Hz), 2.69(2H, d, J6.8 Hz), 1.40(6H, d, J6.2 Hz), 1.21(3H, t, J7.3 Hz), 1.17(3H, t, J7.0 Hz) 0291 Reaction 2 Synthesis of 3-4-(8-chloro-4-isopropoxyquinoline-3-yl)methyloxyphenyl-2-ethoxypropanoic acid: Exemplary Compound (76) 29

0292 The ester compound (880 mg, 1.9 mmol) synthesized by the reaction 1 was subjected to the same treatment as in Example 2 to obtain an intended title compound (740 mg, 89%) as white crystals. 0293 Melting point87 to 88 C. 0294 1H NMR (CDCl3, 270 MHz) d9.10(1H, s), 8.08(1H, dd, J8.1, 1.4 Hz), 7.83(1H, dd, J7.6, 1.4 Hz), 7.47(1H, dd., J8.1, 7.6 Hz), 7.21(2H, d, J8.6 Hz), 6.93(2H, d, J8.6 Hz), 5.23(2H, s), 4.62(1H, sept, J6.2 Hz), 4.07(1H, dd, J7.8, 4.6 Hz), 3.64(1H, dq, J9.0, 6.8 Hz), 3.44(1H, dq, J9.0, 4.8 Hz), 3.09(1H, dd, J14, 4.6 Hz), 2.98(1H, dd, J14, 7.8 Hz), 1.39(6H, d, J6.2 Hz), 1.18(3H, t, J6.8 Hz)

EXAMPLE 14 0295 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-8-trifluoromethylquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (86) 0296 Reaction 1 Synthesis of ethyl 2-ethoxy-3-4-(4-isopropoxy-8-trifluoromethylquinoline-3-yl)methyloxyphenylpropanoate 30

0297 The alcohol compound (710 mg, 2.5 mmol) synthesized in Reference Example 23 and the phenol (610 mg, 2.5 mmol) synthesized in Reference Example 7 were subjected to the same treatment as in Example 1 to obtain an intended title compound (920 mg, 77%) as a colorless transparent oil. 0298 1H NMR (CDCl3, 270 MHz) d9.13(1H, s), 8.37(1H, dd, J8.5, 0.9 Hz), 8.08(1H, d, J7.0 Hz), 7.60(1H, t, J7.7 Hz), 7.19(2H, dd, J6.5, 2.2 Hz), 6.92(2H, dd, J6.8, 2.0 Hz), 5.24(2H, s), 4.61(1H, sept, J6.0 Hz), 4.16(2H, dd, J14, 7.2 Hz), 3.98(1H, t, J6.8 Hz), 3.62(1H, dd, J14, 7.0 Hz), 3.38(1H, dd, J14, 7.0 Hz), 2.97(2H, d, J6.8 Hz), 1.41(6H, d, J6.0 Hz), 1.21(3H, t, J7.2 Hz), 1.17(3H, t, J7.0 Hz) 0299 Reaction 2 Synthesis of 2-ethoxy-3-4-(4-isopropoxy-8-trifluoromethylquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (86) 31

0300 The ester compound (900 mg, 1.8 mmol) synthesized by the reaction 1 was subjected to the same treatment as in Example 2 to obtain an intended title compound (740 mg, 83%) as white crystals. 0301 Melting point113 to 114 C. 0302 1H NMR (CDCl3, 270 MHz) d9.12(1H, s), 8.36(1H, dd, J8.6, 0.8 Hz), 8.09(1H, dd, J6.5, 0.8 Hz), 7.61(1H, m), 7.20(2H, dd, J6.8, 2.1 Hz), 6.93(2H, dd, J6.8, 2.1 Hz), 5.24(2H, s), 4.61(1H, sept, J6.0 Hz), 4.07(1H, dd, J7.3, 4.4 Hz), 3.62(1H, dq, J14, 7.0 Hz), 3.47(1H, dq, J14, 7.0 Hz), 3.10(1H, dd., J14, 4.4 Hz), 2.97(1H, dd, J14, 7.3 Hz), 1.41(6H, d, J6.0 Hz), 1.19(3H, t, J7.0 Hz)

EXAMPLE 15 0303 Synthesis of 2-ethoxy-3-4-(8-fluoro-4-isopropoxyquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (82) 0304 Reaction 1 Synthesis of ethyl 2-ethoxy-3-4-(8-fluoro-4-isopropoxyquinoline-3-yl)methyloxyphenylpropanoate 32

0305 The alcohol compound (610 mg, 2.6 mmol) synthesized in Reference Example 25 and the phenol (620 mg, 2.6 mmol) synthesized in Reference Example 7 were subjected to the same treatment as in Example 1 to obtain an intended title compound (920 mg, 77%) as a colorless transparent oil. 0306 1H NMR (CDCl3, 270 MHz) d9.01(1H, s), 7.90(1H, dd, J8.1, 1.4 Hz), 7.527.36(2H, m), 7.19(2H, dd, J7.0, 2.2 Hz), 6.93(2H, dd, J7.0, 2.2 Hz), 5.23(2H, s), 4.63(1H, sept, J5.9), 4.16(2H, dd, J14, 7.0 Hz), 3.98(1H, t, J6.5 Hz), 3.59(1H, dq, J14, 7.0 Hz), 3.37(1H, dq, J14, 7.0 Hz), 2.97(2H, d, J6.5 Hz), 1.40(6H, d, J5.9 Hz), 1.22(3H, t, J7.0 Hz), 1.17(3H, t, J7.0 Hz) 0307 Reaction 2 Synthesis of 2-ethoxy-3-4-(8-fluoro-4-isopropoxyquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (82) 33

0308 The ester compound (910 mg, 2.0 mmol) synthesized by the reaction 1 was subjected to the same treatment as in Example 2 to obtain an intended title compound (730 mg, 85%) as white crystals. 0309 Melting point131 to 132 C. 0310 1H NMR (CDCl3, 270 MHz) d9.05(1H, s), 7.92(1H, dd, J8.1, 1.5 Hz), 7.657.38(2H, m), 7.23(2H, dd, J6.5, 2.2 Hz), 6.94(2H, dd, J6.5, 2.2 Hz), 5.22(2H, s), 4.65(1H, sept, J6.0 Hz), 4.08(1H, dd, J7.8, 4.6 Hz), 3.67(1H, dq, J9.2, 7.0 Hz), 3.44(1H, dq, J9.2, 7.0 Hz), 3.11(1H, dd, J14, 4.6 Hz), 3.00(1H, dd, J14, 7.8 Hz), 1.40(6H, d, J6.0 Hz), 1.19(3H, t, J7.0 Hz)

EXAMPLE 16 0311 Synthesis of 2-ethoxy-3-4-(quinoline-8-yl)methyloxyphenylpropanoic acid: Exemplary Compound (32) 0312 Reaction 1 Synthesis of ethyl 2-ethoxy-3-4-(quinoline-8-yl)methyloxyphenylpropanoate 34

0313 The alcohol compound (330 mg, 2.1 mmol) synthesized in Reference Example 27 and the phenol (500 mg, 2.1 mmol) synthesized in Reference Example 7 were subjected to the same treatment as in Example 1 to obtain an intended title compound (610 mg, 76%) as a colorless transparent oil. 0314 1H NMR (CDCl3, 270 MHz) d8.94(1H, dd, J4.2, 1.8 Hz), 8.19(1H, dd, J8.1, 1.8 Hz), 7.93(1H, dd, J7.3, 1.4 Hz), 7.77(1H, d, J8.4 Hz), 7.56(1H, t, J8.1 Hz), 7.45(1H, dd, J8.1, 4.3 Hz), 7.17(2H, m), 7.02(2H, m), 5.83(2H, s), 4.16(2H, dd, J14, 7.1 Hz), 3.98(1H, t, J7.0 Hz), 3.60(1H, dq, J9.0, 7.0 Hz), 3.36(1H, dq, J9.0, 7.0 Hz), 2.96(2H, d, J7.0 Hz), 1.21(3H, t, J7.1 Hz), 1.17(3H, t, J7.0 Hz) 0315 Reaction 2 Synthesis of 2-ethoxy-3-4-(quinoline-8-yl)methyloxyphenylpropanoic acid: Exemplary Compound (32) 35

0316 The ester compound (600 mg, 1.6 mmol) synthesized by the reaction 1 was subjected to the same treatment as in Example 2 to obtain an intended title compound (520 mg, 94%) as white crystals. 0317 Melting point178 C. (dec.) 0318 1H NMR (DMSO-d6, 270 MHz) d12.7(1H, brd.s), 8.98(1H, dd J4.2, 1.8 Hz), 8.43(1H, dd, J8.1, 1.8 Hz), 7.98(1H, d, J8.4 Hz), 7.88(1H, d, J7.0 Hz), 7.64(1H, d, J8.4 Hz), 7.60(1H, m), 7.16(2H, d, J8.4 Hz), 6.97(2H, d, J8.4 Hz), 5.72(2H, s), 3.95(1H, dd, J8.1, 5.4 Hz), 3.51(1H, dq, J14, 7.0 Hz), 3.31(1H, dq, J14, 7.0 Hz), 2.90(1H, dd, J14, 5.4 Hz), 2.81(1H, dd, J14, 8.1 Hz), 1.05(3H, t, J7.0 Hz)

EXAMPLE 17 0319 Synthesis of 3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-phenoxypropanoic acid: Exemplary Compound (106) 0320 Reaction 1 Synthesis of methyl 3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-phenoxypropanoate 36

0321 4-Propoxy-6-methoxyquinoline-3-methanol (495 mg, 2 mmol) synthesized in Reference Example 4 and methyl 3-(4-hydroxyphenyl)-2-phenoxypropanoate (545 mg, 2 mmol) synthesized in-Reference Example XX were subjected to the same treatment as in Example 1 to obtain an intended title compound (640 mg, 64%) as a colorless transparent syrup. 0322 1H-N.M.R. (CDCl3, 270 MHz)d8.71(s, 1H), 8.04(d, 1H, J9.5 Hz), 7.407.19(m, 6H), 6.966.88(m, 5H), 5.15(s, 2H), 4.86(t, 1H, J6.0 Hz), 4.62(quintet, 1H, J6.1 Hz), 3.94 and 3.60(2 s, each 3H), 3.31(d, 2H, J6.0 Hz), 1.39(d, 6H, J6.1 Hz) 0323 Reaction 2 Synthesis of 3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-phenoxypropanoic acid: Exemplary Compound (106) 37

0324 The ester compound (630 mg, 1.26 mmol) synthesized by the reaction 1 of Example 17 was subjected to the same treatment as in Example 2 to obtain an intended title compound (480 mg, 78%) as white crystals. 0325 Melting point137 to 139 C. 0326 1H-N.M.R. (CDCl3, 270 MHz)d8.71(s, 1H), 8.04(d, 1H, J9.5 Hz), 7.407.19(m, 6H), 6.966.88(m, 5H), 5.15(s, 2H), 4.86(t, 1H, J6.0 Hz), 4.62(quintet, 1H, J6.1 Hz), 3.94(s, 3H), 3.31(d, 2H, J6.0 Hz), 1.39(d, 6H, J6.1 Hz)

EXAMPLE 18 0327 Synthesis of 3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-phenylthiopropenoic acid: Exemplary Compound (112) 0328 Reaction 1 Synthesis of ethyl 3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-phenylthiopropenoate 38

0329 4-Propoxy-6-methoxyquinoline-3-methanol (613 mg, 2.48 mmol) synthesized in Reference Example 4 and ethyl 3-(4-hydroxyphenyl)-2-phenylthiopropenoate (750 mg, 2.48 mmol) synthesized in Reference Example 33 were subjected to the same treatment as in Example 1 to obtain an intended title compound (1.25 g, 97%) as a colorless transparent syrup. 0330 1H-N.M.R. (CDCl3, 270 MHz)d8.81(s, 1H), 8.10(s, 1H), 7.99(d, 1H, J9.9 Hz), 7.91(d, 2H, J9.0 Hz), 7.407.10(m, 6H), 7.03(d, 2H, J9.0 Hz), 5.27(s, 2H), 4.57(quintet, 1H, J6.2 Hz), 4.12(q, 2H, J7.3 Hz), 3.95(s, 3H), 1.41(d, 6H, J6.1 Hz), 1.06(t, 3H, J7.3 Hz) 0331 Reaction 2 Synthesis of 3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-phenylthiopropenoic acid: Exemplary Compound (112) 39

0332 The ester compound (1.25 g, 2.36 mmol) synthesized by the reaction 1 of Example 18 was subjected to the same treatment as in Example 2 to obtain an intended title compound (890 mg, 75%) as light yellow crystals. 0333 Melting point189 to 191 C. 0334 1H-N.M.R. (CDCl3, 270 MHz)d8.81(s, 1H), 8.10(s, 1H), 7.99(d, 1H, J9.9 Hz), 7.91(d, 2H, J9.0 Hz), 7.407.10(m, 6H), 7.03(d, 2H, J9.0 Hz), 5.27(s, 2H), 4.57(quintet, 1H, J6.2 Hz), 3.95(s, 3H), 1.41(d, 6H, J6.1 Hz)

EXAMPLE 19 0335 Synthesis of 3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-phenylthiopropanoic acid: Exemplary Compound (108) 0336 Reaction 1 Synthesis of methyl 3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-phenylthiopropanoate 40

0337 4-Propoxy-6-methoxyquinoline-3-methanol (618 mg, 2.5 mmol) synthesized in Reference Example 4 and methyl 3-(4-hydroxyphenyl)-2-phenylthiopropanoate (660 mg, 2.29 mmol) synthesized in Reference Example 35 were subjected to the same treatment as in Example 1 to obtain an intended title compound (790 g, 67%) as a colorless transparent syrup. 0338 1H-N.M.R. (CDCl3, 270 MHz)d8.81(s, 1H), 7.99(d, 1H, J9.6 Hz), 7.457.30(m, 7H), 7.13 and 7.03(2 d, each 2H, J8.9 Hz), 5.20(s, 2H), 4.58(quintet, 1H, J6.3 Hz), 3.95 and 3.58(2 s, each 3H), 3.87(dd, 1H, J6.6, 9.2 Hz), 3.12(dd, 1H, J9.2, 13.0 Hz), 3.03(dd, 1H, J6.6, 13.0 Hz), 1.40(d, 6H, J6.3 Hz) 0339 Reaction 2 Synthesis of 3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenyl-2-phenylthiopropanoic acid: Exemplary Compound (108) 41

0340 The ester compound (790 mg, 1.53 mmol) synthesized by the reaction 1 of Example 19 was subjected to the same treatment as in Example 2 to obtain an intended title compound (660 mg, 86%) as a light yellow amorphous material. 0341 1H-N.M.R. (CDCl3, 270 MHz)d8.81(s, 1H), 7.99(d, 1H, J9.6 Hz), 7.457.30(m, 7H), 7.13 and 7.03(2 d, each 2H, J8.9 Hz), 5.20(s, 2H), 4.58(quintet, 1H, J6.3 Hz), 3.95(2 s, each 3H), 3.87(dd, 1H, J6.6, 9.2 Hz), 3.12(dd, 1H, J9.2, 13.0 Hz), 3.03(dd, 1H, J6.6, 13.0 Hz), 1.40(d, 6H, J6.3 Hz)

EXAMPLE 20 0342 Synthesis of 2-ethoxy-3-3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (114) 0343 Reaction 1 Synthesis of ethyl 2-ethoxy-3-3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoate 42

0344 4-Isopropoxy-6-methoxyquinoline-3-methanol (903 mg, 3.65 mmol) synthesized in Reference Example 4 and ethyl 2-ethoxy-3-(3-hydroxyphenyl)propanoate (870 mg, 3.65 mmol) synthesized in Reference Example 36 were subjected to the same treatment as in Example 1 to obtain an intended title compound (1.28 g, 75%) as a colorless transparent syrup. 0345 1H-N.M.R. (CDCl3, 270 MHz)d8.83(s, 1H), 8.00(d, 1H, J8.6 Hz), 7.457.20(m, 3H), 6.94(s, 1H), 6.88(d, 2H, J8.5 Hz), 5.21(s, 2H), 4.60(quintet, 1H, J5.9 Hz), 4.20(q, 2H, J7.3 Hz), 4.02(t, 1H, J6.9 Hz), 3.96(s, 3H), 3.703.52(m, 1H), 3.403.30(m, 1H), 3.00(d, 2H, J6.9 Hz), 1.41(d, 6H, J5.9 Hz), 1.311.13(m, 6H) 0346 Reaction 2 Synthesis of 2-ethoxy-3-3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylpropanoic acid: Exemplary Compound (114) 43

0347 The ester compound (1.28 g, 2.74 mmol) synthesized by the reaction 1 of Example 20 was subjected to the same treatment as in Example 2 to obtain an intended title compound (900 mg, 69%) as white crystals. 0348 Melting point99 to 102 C. 0349 1H-N.M.R. (CDCl3, 270 MHz)d8.83(s, 1H), 8.00(d, 1H, J8.6 Hz), 7.457.20(m, 3H), 6.94(s, 1H), 6.88(d, 2H, J8.5 Hz), 5.21(s, 2H), 4.60(quintet, 1H, J5.9 Hz), 4.02(t, 1H, J6.9 Hz), 3.96(s, 3H), 3.703.52(m, 1H), 3.403.30(m, 1H), 3.00(d, 2H, J6.9 Hz), 1.41(d, 6H, J5.9 Hz), 1.21(t, 3H, J7.3 Hz)

EXAMPLE 21 0350 Synthesis of 2-ethoxy-3-3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxy-4-methoxyphenylpropanoic acid: Exemplary Compound (118) 0351 Reaction 1 Synthesis of ethyl 2-ethoxy-3-3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxy-4-methoxyphenylpropanoate 44

0352 4-Isopropoxy-6-methoxyquinoline-3-methanol (558 mg, 2.26 mmol) synthesized in Reference Example 4 and ethyl 2-ethoxy-3-(3-hydroxy-4-methoxyphenyl)propanoate (610 mg, 2.26 mmol) synthesized in Reference Example 37 were subjected to the same treatment as in Example 1 to obtain an intended title compound (580 g, 52%) as a colorless transparent syrup. 0353 1H-N.M.R. (CDCl3, 270 MHz)d8.87(s, 1H), 7.97(d, 1H, J8.6 Hz), 7.407.33(m, 3H), 6.96(s, 1H), 6.82(s, 1H), 5.29(s, 2H), 4.65(quintet, 1H, J5.9 Hz), 4.14(q, 2H, J7.3 Hz), 3.95 and 3.84(2 s, each 3H), 3.92(t, 1H, J6.7 Hz), 3.603.45(m, 1H), 3.303.20(m, 1H), 2.90(d, 2H, J6.7 Hz), 1.42(d, 6H, J5.9 Hz), 1.22(t, 3H, J7.3 Hz), 1.11(t, 3H, J7.3 Hz) 0354 Reaction 2 Synthesis of 2-ethoxy-3-3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxy-4-methoxyphenylpropanoic acid: Exemplary Compound (114) 45

0355 The ester compound (570 g, 1.14 mmol) synthesized by the reaction 1 of Example 21 was subjected to the same treatment as in Example 2 to obtain an intended title compound (510 mg, 88%) as white crystals. 0356 Melting point144 to 146 C. 0357 1H-N.M.R. (DMSO-d6, 270 MHz)d8.23(d, 1H, J9.3 Hz), 7.75(dd, 1H, J2.6, 9.3 Hz), 7.55(d, 1H, J2.6 Hz), 7.12(d, 1H, J2.6 Hz), 6.93(d, 1H, J9.3 Hz), 6.84(d, 1H, J9.3 Hz), 5.31(s, 2H), 5.04(quintet, 1H, J5.9 Hz), 4.00 and 3.74(2 s, each 3H), 3.98(dd, 1H, J2.2, 5.0 Hz), 3.513.45(m, 1H), 3.303.25(m, 1H), 2.92(dd, 1H, J5.0, 11.2 Hz), 2.80(dd, 1H, J2.2, 11.2 Hz), 1.43(d, 6H, J5.9 Hz), 1.01(t, 3H, J6.9 Hz)

EXAMPLE 22 0358 Synthesis of dimethyl4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonate hydrochloride: Exemplary Compound (120) 46

0359 4-Isopropoxy-6-methoxyquinoline-3-methanol (742 mg, 3 mmol) synthesized in Reference Example 4 and dimethyl (4-hydroxyphenyl)methylmalonate (1.05 g, 4.5 mmol) synthesized in Reference Example 40 were subjected to the same treatment as in Example 1, followed by treatment with 4 N hydrochloric acid and dioxane, to obtain an intended title compound (890 mg, 59%) as white crystals. 0360 Melting point140 C. (dec.) 0361 1H-N.M.R. (DMSO-d6, 270 MHz)d9.18(s, 1H), 8.23(d, 1H, J9.3 Hz), 7.75(dd, 1H, J2.7, 9.3 Hz), 7.54(d, 1H, J2.7 Hz), 7.18 and 7.02(2 d, each 2H, J8.4 Hz), 5.32(s, 2H), 4.97(quintet, 1H, J6.3 Hz), 4.00(s, 3H), 3.83(t, 1H, J7.9 Hz), 3.61(s, 6H), 3.05(d, 2H, J7.9 Hz), 1.43(d, 6H, J6.3 Hz)

EXAMPLE 23 0362 Synthesis of methyl 2-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3-oxopentanoate hydrochloride: Exemplary Compound (137) 47

0363 4-Isopropoxy-6-methoxyquinoline-3-methanol (989 mg, 4 mmol) synthesized in Reference Example 4 and methyl 2-(4-hydroxyphenyl)methyl-3-oxopentanoate (1.0 g, 4 mmol) synthesized in Reference Example 40 were subjected to the same treatment as in Example 1, followed by treatment with 4 N hydrochloric acid and dioxane, to obtain an intended title compound (1.25 g, 62%) as white crystals. 0364 Melting point107 C. (dec.) 0365 1H-N.M.R. (DMSO-d6, 270 MHz)d9.18(s, 1H), 8.28(d, 1H, J9.3 Hz), 7.77(dd, 1H, J2.7, 9.3 Hz), 7.55(d, 1H, J2.7 Hz), 7.18 and 7.02(2 d, each 2H, J8.4 Hz), 5.32(s, 2H), 4.98(quintet, 1H, J6.0 Hz), 4.02(t, 1H, J8.0 Hz), 4.00(s, 3H), 3.59(s, 3H), 2.99(d, 2H, J8.0 Hz), 2.612.37(m, 2H), 1.42(d, 6H, J6.0 Hz), 0.86(t, 3H, J7.3 Hz)

EXAMPLE 24 0366 Synthesis of 2-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethyl-3-oxobutanoic acid N-methylamide: Exemplary Compound (141) 48

0367 4-Isopropoxy-6-methoxyquinoline-3-methanol (1.12 g, 4.52 mmol) synthesized in Reference Example 4 and 2-(4-hydroxyphenyl)methyl-3-oxobutanoic acid N-methylamide (1.0 g, 4.52 mmol) synthesized in Reference Example 42 were subjected to the same treatment as in Example 1 to obtain an intended title compound (870 mg, 43%) as a colorless transparent syrup. 0368 1H-N.M.R. (CDCl3, 270 MHz)d8.80(s, 1H), 7.98(d, 1H, J9.6 Hz), 7.707.35(m, 2H), 7.09 and 6.92(2 d, each 2H, J8.5 Hz), 6.20(q, 1H, J4.6 Hz), 5.20(s, 2H), 4.57(quintet, 1H, J5.3 Hz), 3.96(s, 3H), 3.60(dd, 1H, J5.9, 8.2 Hz.), 3.16(dd, 1H, J5.9, 13.5 Hz), 3.05(dd, 1H, J8.2, 13.5 Hz), 2.76(d, 3H, J4.6 Hz), 2.10(s, 3H), 1.40(d, 6H, J5.3 Hz)

EXAMPLE 25 0369 Synthesis of 2-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylene-3-oxobutanoic acid N-methylamide hydrochloride: Exemplary Compound (144) 0370 Reaction 1 Synthesis of (4-isopropoxy-6-methoxyquinoline-3-yl)methyloxybenzaldehyde 49

0371 4-Isopropoxy-6-methoxyquinoline-3-methanol (4.95 g, 20 mmol) synthesized in Reference Example 4 and 4-hydroxybenzaldehyde (2.93 g, 24 mmol) were subjected to the same treatment as in Example 1 to obtain an intended title compound (3.84 g, 55%) as a colorless transparent syrup. 0372 1H-N.M.R. (CDCl3, 270 MHz)d9.00(s, 1H), 8.82(s, 1H), 8.01(d, 1H, J9.9 Hz), 7.86(d, 2H, J8.9 Hz), 7.417.36(m, 2H), 7.12(d, J8.9 Hz), 5.33(s, 2H), 4.58(quintet, 1H, J6.0 Hz), 3.96(s, 3H), 1.42(d, 6H, J6.0 Hz) 0373 Reaction 2 Synthesis of 2-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylene-3-oxobutanoic acid N-methylamide hydrochloride: Exemplary Compound (144) 50

0374 The aldehyde compound (1.0 g, 2.85 mmol) synthesized by the reaction 1 of Example 25 was suspended in toluene (25 ml). Thereto were added a 65% aqueous N-methylacetoacetamide solution (531 mg, 3.0 mmol) and piperidine acetate (200 mg). The mixture was refluxed for 6 hours with heating. The reaction mixture was allowed to cool and poured into water (100 ml), and extraction of an intended compound was conducted using ethyl acetate. The organic layer was subjected to vacuum concentration. The residue was purified by silica gel column chromatography (equivalent product of Merck C-300: 60 g, acetone:toluene1:2) to obtain a colorless transparent syrup (450 mg). The syrup was treated with 4 N hydrochloric acid and dioxane to obtain an intended title compound (270 mg, 20%) as a colorless amorphous material. 0375 1H-N.M.R. (DMSO-d6, 270 MHz)d9.21(s, 1H), 8.288.24(m, 2H), 7.77(dd, 1H, J2.5, 8.5 Hz), 7.61(d, 2H, J8.9 Hz), 7.577.49(m, 2H), 7.20(d, 2H, J8.9 Hz), 5.41(s, 2H), 4.97(quintet, 1H, J5.9 Hz), 4.01(s, 3H), 2.69(d, 3H, J4.6 Hz), 2.33(s, 3H), 1.43(d, 6H, J5.9 Hz)

EXAMPLE 26 0376 Synthesis of 3-4-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylene-2,4-dioxopentane: Exemplary Compound (147) 51

0377 The aldehyde compound (1.0 g, 2.85 mmol) synthesized by the reaction 1 of Example 25 and acetylacetone (300 mg, 3.0 mmol) were subjected to the same treatment as in the reaction 2 of Example 25 to obtain an intended title compound (680 mg, 55%) as light yellow crystals. 0378 Melting point114 to 115 C. 0379 1H-N.M.R. (CDCl3, 270 MHz)d8.81(s, 1H), 7.98(dd, 1H, J3.0, 6.9 Hz), 7.427.36(m, 5H), 7.01(d, 2H, J8.7 Hz), 5.28(s, 2H), 4.56(quintet, 1H, J6.1 Hz), 3.97(s, 3H), 2.41 and 2.33(2 s, each 3H), 1.42(d, 6H, J6.1 Hz)

EXAMPLE 27 0380 Synthesis of diethyl3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxyphenylmethylmalonate hydrochloride: Exemplary Compound (128) 52

0381 4-Isopropoxy-6-methoxyquinoline-3-methanol (742 mg, 3 mmol) synthesized in Reference Example 4 and diethyl 3-hydroxyphenyl)methylmalonate (1.2 g, 4.5 mmol) synthesized in Reference Example 44 were subjected to the same treatment as in Example 1, followed by treatment with 4 N hydrochloric acid and dioxane, to obtain an intended title compound (1.34 g, 90%) as white crystals. 0382 Melting point114 C. (dec.) 0383 1H-N.M.R. (DMSO-d6, 270 MHz)d9.20(s, 1H), 8.26(d, 1H, J9.2 Hz), 7.76(dd, 1H, J2.9, 9.5 Hz), 7.55(d, 1H, J2.9 Hz), 7.25(t, 1H, J8.0 Hz), 6.99(s, 1H), 6.96(d, 1H, J8.6 Hz), 6.86(d, 1H, J8.6 Hz), 5.33(s, 2H), 4.99(quintet, 1H, J6.0 Hz), 4.10(q, 4H, J7.3 Hz), 4.01(s, 3H), 3.84(t, 1H, J8.1 Hz), 3.08(d, 2H, J8.1 Hz), 1.44(d, 6H, J6.3 Hz), 1.10(t, 6H, J7.3 Hz)

EXAMPLE 28 0384 Synthesis of diethyl3-(4-isopropoxy-6-methoxyquinoline-3-yl)methyloxy-4-methoxyphenylmethylmalonate hydrochloride: Exemplary Compound (129) 53

0385 4-Isopropoxy-6-methoxyquinoline-3-methanol (620 mg, 2.5 mmol) synthesized in Reference Example 4 and diethyl 3-hydroxy-4-methoxyphenyl)methylmalonate (1.11 g, 3.76 mmol) synthesized in Reference Example 46 were subjected to the same treatment as in Example 1, followed by treatment with 4 N hydrochloric acid and dioxane, to obtain an intended title compound (920 mg, 65%) as white crystals. 0386 Melting point132 to 134 C. 0387 1H-N.M.R. (DMSO-d6, 270 MHz)d9.17(s, 1H), 8.29(d, 1H, J9.2 Hz), 7.78(dd,1H, J2.9, 9.2 Hz), 7.56(d, 1H, J2.9 Hz), 7.13(s, 1H), 6.92(d, 1H, J8.3 Hz), 6.82(d, 1H, J8.3 Hz), 5.31(s, 2H), 5.05(quintet, 1H, J6.3 Hz), 4.05(q, 4H, J7.2 Hz), 4.01(s, 3H), 3.83(t, 1H, J8.0 Hz), 3.73(s, 3H), 3.03(d, 2H, J8.0 Hz), 1.44(d, 6H, J6.3 Hz), 1.10(t, 6H, J7.2 Hz)

REFERENCE EXAMPLE 1 0388 Synthesis of diethyl 4-methoxyphenylaminomethylenemalonate 54

0389 4-Methoxyaniline (49.3 g, 0.4 mol) was mixed with diethyl ethoxymethylenemalonate (86.5 g, 0.4 mol). The mixture was stirred at 120 C. for 2 hours and then cooled. The ethanol formed was removed by vacuum distillation to obtain an intended title compound as a brown crude syrup (117 g, 100%). 0390 1H-N.M.R. (DMSO-d6, 270 MHz)d10.70(d, 1H, J9.0 Hz), 8.31(d, 1H, J9.0 Hz), 7.30and6.95(2 d, each 2H, J8.5 Hz), 4.18 and 4.12(2 q, each 2H, J7.3 Hz), 3.75(s, 3H), 1.25 and 1.23(2 t, each 3H, J7.3 Hz)

REFERENCE EXAMPLE 2 0391 Synthesis of ethyl 4-hydroxy-6-methoxyquinoline-3-carboxylate 55

0392 The malonic acid derivative (117 g, 0.4 mol) synthesized in Reference Example 1 was dissolved in diphenyl ether (500 ml). The solution was stirred at 260 C. for 1 hour. The resulting material was cooled slowly to room temperature with stirring, to obtain intended crude crystals. The crude crystals were collected by filtration and then subjected to sludging with ethyl acetate (300 ml) to obtain an intended title compound (44.2 g, 45%) as brown crystals. 0393 Melting point>260 C. 0394 1H-N.M.R. (DMSO-d6, 270 MHz)d8.49(s, 1H), 7.59(d, 1H, J8.8 Hz), 7.58(d, 1H, J2.9 Hz), 7.33(dd, 1H, J2.9, 8.8 Hz), 4.24(q, 2H, J7.1 Hz), 3.85(s, 3H), 1.29(t, 3H, J7.1 Hz)

REFERENCE EXAMPLE 3 0395 Synthesis of ethyl 4-isopropoxy-6-methoxyquinoline-3-carboxylate 56

0396 The quinolinol derivative (25 g, 0.1 mol) synthesized in Reference Example 2 was dissolved in methylene chloride (400 ml). Thereto were added, at room temperature, 2-propanol (12.1 g, 0.2 mol), triphenylphosphine (34.3 g, 0.13 mol) and diethyl azodicarboxylate (22.8 g, 0.13 mol). The mixture was stirred at room temperature for 4 hours and then diluted with chloroform (500 ml). The resulting material was washed with water. The organic layer was dried over anhydrous magnesium sulfate and then subjected to vacuum concentration. The residue was purified by silica gel column chromatography (equivalent product of Merck C-300: 500 g, ethyl acetate:hexane1:2) to obtain an intended title compound (27.5 g, 94%) as a light yellow transparent syrup. 0397 1H-N.M.R. (CDCl3, 270 MHz)d8.90(s, 1H), 7.95(d, 1H, J8.8 Hz), 7.557.45(m, 2H), 4.60(quintet, 1H, J6.3 Hz), 4.40(q, 2H, J7.3 Hz), 3.90(s, 3H), 1.35(t, 3H, J7.3 HZ), 1.30(d, 6H, J7.3 Hz)

REFERENCE EXAMPLE 4 0398 Synthesis of 4-isopropoxy-6-methoxyquinoline-3-methanol 57

0399 The quinoline derivative (5.0 g, 17.3 mmol) synthesized in Reference Example 3 was dissolved in methylene chloride (150 ml). Thereto was dropwise added a toluene solution containing 1 M diisobutyl aluminum hydride at 60 to 50 C. The mixture was heated to 0 C. and stirred for 2 hours. To the reaction mixture was added a saturated aqueous sodium sulfate solution. The resulting precipitate was collected by filtration, followed by washing with ethyl acetate. The filtrate was subjected to vacuum concentration. The residue was purified by silica gel column chromatography (equivalent product of Merck C-300: 120 g, methanol:chloroform1:20). Successively, crystallization was conducted using a small amount of a mixed solvent consisting of ethyl acetate and hexane, to obtain an intended title compound (4.05 g, 95%) as light yellow crystals. 0400 Melting point66 to 68 C. 0401 1H-N.M.R. (CDCl3, 270 MHz)d8.75(s, 1H), 7.95(d, 1H, J8.5 Hz), 7.357.25(m, 2H), 4.88(s, 2H), 4.62(quintet, 1H, J6.5 Hz), 4.40(q, 2H, J7.3 Hz), 3.93(s, 3H), 1.42(d, 6H, J7.3 Hz)

REFERENCE EXAMPLE 5 0402 Synthesis of ethyl 3-(4-benzyloxyphenyl)-2-ethoxy-3-hydroxypropanaote 58

0403 Diisopropylamine (6.07 g, 60 mmol) was dissolved in tetrahydrofuran (120 ml). Thereto was dropwise added a hexane solution of 1.5 M n-butyl lithium (40 ml, 60 mmol) slowly at 60 C. The mixture was heated to 0 C., stirred for 20 minutes, and cooled again to 60 C. Thereto was dropwise added slowly a solution of ethyl ethoxyacetate (7.93 g, 60 mmol) dissolved in tetrahydrofuran (40 ml). The mixture was stirred at the same temperature for 1 hour. Then was dropwise added a solution of 4-benzyloxybenzaldehyde (10.6 g, 50 mmol) dissolved in tetrahydrofuran (80 ml). The mixture was stirred at the same temperature for 1 hour. To the reaction mixture was added a saturated aqueous ammonium chloride solution (250 ml) and the mixture was heated to room temperature. Extraction of an intended compound was conducted using ethyl acetate. The organic layer was washed with water, dried over anhydrous magnesium sulfate, and subjected to vacuum concentration. The residue was purified by silica gel column chromatography (NHDM-1020 produced by Fuji Silysia Chemical Ltd.: 250 g, ethyl acetate:hexane1:2) to obtain an intended title compound (14.6 g, 85%) as a colorless transparent syrup-like diastereomer mixture. 0404 1H-N.M.R. (CDCl3, 270 MHz)d7.907.26(m, 7H), 6.94(d, 2H, J9.8 Hz), 5.06(s, 2H), 4.904.85(m, 0.75H), 4.804.75(m, 0.25H), 4.143.90(m, 3H), 3.753.40(m, 2H), 2.98(d, 0.25H, J3.9 Hz), 2.90(d, 0.75H, J3.9 Hz), 1.261.05(m, 6H)

REFERENCE EXAMPLE 6 0405 Synthesis of ethyl 3-(4-benzyloxyphenyl)-2-ethoxypropanoate 59

0406 The alcohol compound (13.0 g, 37.7 mmol) obtained in Reference Example 5 was dissolved in methylene chloride (120 ml). Thereto were added trifluoroacetic acid (30 ml) and triethylsilane (13.2 g, 113 mmol) at room temperature. The mixture was stirred at room temperature for 4 hours and then poured into a saturated aqueous sodium bicarbonate solution. The organic layer was separated, dried over anhydrous magnesium sulfate and subjected to vacuum concentration. The residue was purified by silica gel column chromatography (equivalent product of Merck C-300: 200 g, ethyl acetate:hexane1:4) to obtain an intended title compound (11.5 g, 92%) as a colorless transparent syrup. 0407 1H-N.M.R. (CDCl3, 270 MHz)d7.457.25(m, 5H), 7.16 and 6.89(2 d, each 2H, J8.5 Hz), 5.04(s, 2H), 4.16(q, 2H, J7.3 Hz), 3.97(t, 1H, J6.3 Hz), 3.633.57(m, 1H), 3.383.32(m, 1H), 2.95(d, 2H, J6.6 Hz), 1.67(t, 3H, J7.7 Hz), 1.22(t, 3H, J7.7 Hz)

REFERENCE EXAMPLE 7 0408 Synthesis of ethyl 2-ethoxy-3-(4-hydroxyphenyl)propanoate 60

0409 The ester compound (11.0 g, 33.3 mmol) obtained in Reference Example 6 was dissolved in ethanol (159 mmol). Thereto was added 10% palladium-carbon (containing 50% of water) (2.2 g, 1 wt. % as Pd). The mixture was stirred vigorously in a hydrogen atmosphere at normal pressure at room temperature for 3 hours. The catalyst was removed from the reaction mixture by filtration using Celite. The filtrate was subjected to vacuum concentration to obtain an intended title compound (7.06 g, 89%) as a crude syrup. 0410 1H-N.M.R. (CDCl3, 270 MHz)d7.08 and 6.73(2 d, each 2H, J8.6 Hz), 4.17(q, 2H, J7.0 Hz), 3.99(t, 1H, J6.6 Hz), 3.663.55(m, 1H), 3.433.32(m, 1H), 2.95(d, 2H, J6.6 Hz), 1.23(t, 3H, J7.7 Hz), 1.17(t, 3H, J7.7 Hz)

REFERENCE EXAMPLE 8 0411 Synthesis of ethyl 4-isopropoxy-5,7-dimethylquinoline-3-carboxylate 61

0412 3,5-Dimethylaniline (12.1 g, 0.1 mol) and diethyl ethoxymethylenemalonate (21.6 g, 0.1 mol) were used as starting materials and subjected to the same treatment as in Reference Examples 1 to 3 to obtain an intended title compound (10.1 g, 35%) as a brown syrup. 0413 1H-N.M.R. (CDCl3, 270 MHz)d9.04(s, 1H), 7.68(s, 1H), 7.15(s, 1H), 4.61(quintet, 1H, J6.3 Hz), 4.44(q, 2H, J7.0 Hz), 2.89 and 2.49(2 s, each 3H), 1.44(t, 3H, J7.0 HZ), 1.33(d, 6H, J6.3 Hz)

REFERENCE EXAMPLE 9 0414 Synthesis of 4-isopropoxy-5,7-dimethylquinoline-3-methanol 62

0415 The ester compound (3.5 g, 12.2 mmol) obtained in Reference Example 8 was subjected to the same treatment as in Reference Example 4 to obtain an intended title compound (2.24 g, 75%) as a light yellow syrup. 0416 1H-N.M.R. (CDCl3, 270 MHz)d8.72(s, 1H), 7.64(s, 1H), 7.10(s, 1H), 4.85(s, 2H), 4.54(quintet, 1H, J6.3 Hz), 2.82 and 2.45(2 s, each 3H), 1.29(d, 6H, J6.3 Hz)

REFERENCE EXAMPLE 10 0417 Synthesis of ethyl 6-ethyl-4-isopropoxyquinoline-3-carboxylate 63

0418 4-Ethylaniline (12.1 g, 0.1 mol) and diethyl ethoxymethylenemalonate (21.6 g, 0.1 mol) were used as starting materials and subjected to the same treatment as in Reference Examples 1 to 3 to obtain an intended title compound (13.5 g, 55%) as a brown syrup. 0419 1H-N.M.R. (CDCl3, 270 MHz)d9.14(s, 1H), 8.06(d, 1H, J1.9 Hz), 8.00(d, 1H, J8.6 Hz), 7.64(dd, 1H, J1.9, 8.6 Hz), 4.69(quintet, 1H, J6.3 Hz), 4.46(q, 2H, J7.3 Hz), 2.86(q, 2H, J7.5 Hz), 1.45(t, 3H, J7.3 Hz), 1.39(d, 6H, J6.3 Hz), 1.34(t, 3H, J7.5 Hz)

REFERENCE EXAMPLE 11 0420 Synthesis of 6-ethyl-4-isopropoxyquinoline-3-methanol 64

0421 The ester compound (4.91 g, 20 mmol) obtained in Reference Example 10 was subjected to the same treatment as in Reference Example 4 to obtain an intended title compound (3.53 g, 72%) as light yellow crystals. 0422 Melting point43 to 46 C. 0423 1H-N.M.R. (CDCl3, 270 MHz)d8.80(s, 1H), 7.98(d, 1H, J1.5 Hz), 7.84(d, 1H, J8.6 Hz), 7.54(dd, 1H, J1.5, 8.6 Hz), 4.90(s, 2H), 4.65(quintet, 1H, J6.0 Hz), 2.85(q, 2H, J7.6 Hz), 1.40(d, 6H, J6.0 Hz), 1.34(t, 3H, J7.6 Hz)

REFERENCE EXAMPLE 12 0424 Synthesis of ethyl 6-methoxy-4-octyloxyquinoline-3-carboxylate 65

0425 The quinolinol derivative (2.47 g, 10 mmol) synthesized in Reference Example 2 was dissolved in methylene chloride (70 ml). Thereto were added, at room temperature, 1-octanol (3.26 g, 25 mmol), triphenylphosphine (3.93 g, 15 mmol) and diethyl azodicarboxylate (2.61 g, 15 mmol). The mixture was stirred at room temperature for 4 hours and then diluted with chloroform (200 ml). The resulting material was washed with water. The organic layer was dried over anhydrous magnesium sulfate and then subjected to vacuum concentration. The residue was purified by silica gel column chromatography (equivalent product of Merck C-300: 100 g, ethyl acetate:hexane1:5) to obtain an intended title compound (2.82 g, 79%) as a light yellow transparent syrup. 0426 1H-N.M.R. (CDCl3, 270 MHz)d9.03(s, 1H), 7.99(d, 1H, J9.2 Hz), 7.53(d, 1H, J2.5 Hz), 7.43(dd, 1H, J2.5, 9.2 Hz), 4.46(q, 2H, J7.3 Hz), 4.23(t, 2H, J7.2 Hz), 3.95(s, 3H), 1.981.90(m, 2H), 1.601.50(m, 2H), 1.301.20(m, 11H), 0.88(t, 3H, J6.6 Hz)

REFERENCE EXAMPLE 13 0427 Synthesis of 6-methoxy-4-octyloxyquinoline-3-methanol 66

0428 The ester compound (2.6 g, 7.23 mmol) obtained in Reference Example 12 was subjected to the same treatment as in Reference Example 4 to obtain an intended title compound (1.25 g, 54%) as a light yellow syrup. 0429 1H-N.M.R. (CDCl3, 270 MHz)d8.81(s, 1H), 8.00(d, 1H, J9.2 Hz), 7.407.35(m, 2H), 4.88(s, 2H), 4.20(t, 2H, J7.0 Hz), 3.95(s, 3H), 2.001.90(m, 2H), 1.601.50(m, 2H), 1.301.15(m, 8H), 0.88(t, 3H, J6.6 Hz)

REFERENCE EXAMPLE 14 0430 Synthesis of 6,7-dimethoxy-4-isopropoxyquinoline-3-methanol 67

0431 3,5-Dimethoxylaniline (15.3 g, 0.1 mol) and diethyl ethoxymethylenemalonate (21.6 g, 0.1 mol) were used as starting materials and subjected to the same treatment as in Reference Examples 1 to 3 to obtain an intended title compound (7.98 g, 25%) as a brown crude syrup. The ester obtained (2.00 g, 6.26 mmol) was subjected to the same treatment as in Reference Example 4 to obtain an intended title compound (1.33 g, 77%) as a light yellow syrup. 0432 1H-N.M.R. (CDCl3, 270 MHz)d8.77(s, 1H), 7.41(s, 1H), 7.37(s, 1H), 4.88(s, 2H), 4.62(quintet, 1H, J6.5 Hz), 4.04 and 3.98(2 s, each 3H), 1.40(d, 6H, J6.5 Hz)

REFERENCE EXAMPLE 15 0433 Synthesis of 2-phenylquinoline-4-methanol 68

0434 Methyl 2-phenylquinoline-4-carboxylate (3.0 g) was subjected to the same treatment as in Reference Example 3 to obtain an intended title compound (1.93 g, 72%). 0435 1H-N.M.R. (CDCl3, 270 MHz)d8.228.11(m, 3H), 7.967.90(m, 2H), 7.73(t, 1H, J8.6 Hz), 7.577.42(m, 4H), 5.23(s, 2H)

REFERENCE EXAMPLE 16 0436 Synthesis of quinoline-6-methanol 69

0437 Ethyl quinoline-6-carboxylate (1.78 g) was subjected to the same treatment as in Reference Example 3 to obtain an intended title compound (1.31 g, 93%). 0438 1H-N.M.R. (CDCl3, 270 MHz)d8.88(d, 1H, J4.0 Hz), 8.208.06(m, 2H), 7.81(s, 1H), 7.70(d, 1H, J8.6 Hz), 7.40(d, 1H, J8.6 Hz), 4.91(s, 2H)

REFERENCE EXAMPLE 17 0439 Synthesis of methyl 4-methoxyquinoline-2-carboxylate 70

0440 4-Methoxyquinoline-2-carboxylic acid (2.42 g) was dissolved in 13% hydrochloric acid-methanol (45 ml). The solution was refluxed for 8 hours, with heating. The reaction mixture was subjected to vacuum distillation. To the residue were added a saturated aqueous sodium bicarbonate solution and ethyl acetate. The ethyl acetate layer was separated, dried over anhydrous magnesium sulfate, and subjected to vacuum concentration to obtain an intended title compound (1.08 g, 42%) as a light brown syrup. 0441 1H-N.M.R. (CDCl3, 270 MHz)d8.24(d, 2H, J8.6 Hz), 7.77(t, 1H, J6.9 Hz), 7.647.58(m, 2H), 4.14(s, 3H), 4.09(s, 3H)

REFERENCE EXAMPLE 18 0442 Synthesis of 4-methoxyquinoline-2-methanol 71

0443 The ester compound (500 mg) obtained in the synthesis of Reference Example 17 was subjected to the same treatment as in Reference Example 3 to obtain an intended title compound (340 mg, 78%) as a colorless transparent-syrup. 0444 1H-N.M.R. (CDCl3, 270 MHz)d8.17(d, 1H, J8.3 Hz), 7.99(d, 1H, J8.3 Hz), 7.70(t, 1H, J6.9 Hz), 7.49(t, 1H, J6.9 Hz), 6.62(s, 1H), 4.86(s, 2H), 4.05(s, 3H)

REFERENCE EXAMPLE 19 0445 Synthesis of 4-isopropyl-7-trifluoromethylquinoline-3-methanol 72

0446 Ethyl4-isopropyl-7-trifluoromethylquinoline-3-carboxylate (4.73 g) was subjected to the same treatment as in Reference Example 3 to obtain an intended title compound (570 mg, 14%) as a colorless transparent syrup. 0447 1H-N.M.R. (CDCl3, 270 MHz)d9.02(s, 1H), 8.38(s, 1H), 8.22(d, 1H, J8.9 Hz), 7.70(dd, 1H, J1.7, 8.6 Hz), 4.96(s, 2H), 4.66(m, 1H), 1.43(d, 6H, J5.9 Hz)

REFERENCE EXAMPLE 20 0448 Synthesis of ethyl 8-chloro-4-isopropoxyquinoline-3-carboxylate 73

0449 Ethyl 8-chloro-4-hydroxyquinoline-3-carboxylate (5.22 g, 22.2 mmol) was subjected to the same treatment as in Reference Example 3 to obtain an intended title compound (3.32 g, 92%) as a colorless transparent oil. 0450 1H NMR (CDCl3, 270 MHz)) d9.27(1H, d, J3.2 Hz), 8.20(1H, d, J2.2 Hz), 7.87(1H, d, J2.2 Hz), 4.75(1H, sept, J5.9 Hz), 4.48(2H, dd, J14, 7.2 Hz), 1.45(3H, t, J7.2 Hz), 1.39(6H, d, J5.9 Hz)

REFERENCE EXAMPLE 21 0451 8-Cloro-4-isopropoxyquinoline-3-methanol 74

0452 The ester compound (3.28 g, 11.2 mmol) synthesized in Reference Example 20 was subjected to the same treatment as in Reference Example 4 to obtain an intended title compound (2.25 g, 79%) as white crystals. 0453 Melting point88 to 89 C. 0454 1H NMR (CDCl3, 270 MHz)d9.02(1H, s), 8.01(1H, dd, J8.6, 1.4 Hz), 7.80(1H, dd, J7.3, 1.4 Hz), 7.43(1H, dd., J8.6, 7.3 Hz), 4.92(2H, brd.s), 4.63(1H, sept, J6.2 Hz), 2.79(1H, brd.s), 1.39(6H, d, J6.2 Hz)

REFERENCE EXAMPLE 22 0455 Ethyl 4-isopropoxy-8-trifluoromethylquinoline-3-carboxylate 75

0456 Ethyl 4-hydroxy-8-trifluoromethylquinoline-3-carboxylate (2.11 g, 7.4 mmol) was subjected to the same treatment as in Reference Example 3 to obtain an intended title compound (2.24 g, 92%) as a colorless transparent oil. 0457 1H NMR (CDCl3, 270 MHz) d9.37(1H, d, J3.5 Hz), 8.54(1H, dd, J8.6, 0.8 Hz), 8.14(1H, dd, J7.3, 0.8 Hz), 7.62(1H, dd., J8.6, 7.3 Hz), 4.77(1H, sept, J6.2 Hz), 4.48(2H, dd, J14, 7.3 Hz), 1.45(3H, t, J7.3 Hz), 1.40(6H, d, J6.2 Hz)

REFERENCE EXAMPLE 23 0458 4-Isopropoxy-8-trifluoromethylquinoline-3-methanol 76

0459 The ester compound (1.24 g, 3.8 mmol) synthesized in Reference Example 22 was subjected to the same treatment as in Reference Example 4 to obtain an intended title compound (0.91 g, 84%) as white crystals. 0460 Melting point73 to 74 C. 0461 1H NMR (CDCl3, 270 MHz) d9.07(1H, s), 8.32(1H, dd, J8.6, 0.5 Hz), 8.05(1H, dd, J7.3, 0.5 Hz), 7.57(1H, t, J8 . . . 0 Hz), 4.93(2H, d, J5.8 Hz), 4.64(1H, sept, J6.0 Hz), 2.39(1H, t, J5.8 Hz), 1.41(6H, d, J6.0 Hz)

REFERENCE EXAMPLE 24 0462 Ethyl8-fluoro-4-isopropoxyquinoline-3-carboxylate 77

0463 Ethyl 8-fluoro-4-hydroxyquinoline-3-carboxylate (5.22 g, 22.2 mmol) was subjected to the same treatment as in Reference Example 3 to obtain an intended title compound (5.76 g, 94%) as a light yellow oil. 0464 1H NMR (CDCl3, 270 MHz) d9.23(1H, s), 8.147.98(1H, m), 7.557.45(2H, m), 4.74(1H, sept, J6.2 Hz), 4.48(2H, dd, J15, 7.2 Hz), 1.46(3H, t, J7.2 Hz), 1.39(6H, d, J6.2 Hz)

REFERENCE EXAMPLE 25 0465 8-Fluoro-4-isopropoxyquinoline-3-methanol 78

0466 The ester compound (2.00 g, 7.2 mmol) synthesized in Reference Example 24 was subjected to the same treatment as in Reference Example 4 to obtain an intended title compound (1.19 g, 71%) as white crystals. 0467 1H NMR (CDCl3, 270 MHz) d8.95(1H, s), 7.65(1H, dt, J7.8, 1.6 Hz), 7.45(1H, m), 7.38(1H, ddd, J9.0, 2.7, 1.6 Hz), 4.93(2H, s), 4.65(1H, sept, J6.2 Hz), 3.51(1H, brd.s), 1.39(6H, d, J6.2 Hz)

REFERENCE EXAMPLE 26 0468 Ethyl quinoline-8-carboxylate 79

0469 Quinoline-8-carboxylic acid (1.43 g, 8.3 mmol) was dissolved in ethanol (40 ml). Thereto was added sulfuric acid (0.3 ml), followed by refluxing for 12 hours with heating. The most part of ethanol was removed from the reaction mixture by vacuum distillation. To the residue was added a saturated aqueous sodium bicarbonate solution. Extraction of an intended compound was conducted using ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and then subjected to vacuum concentration to obtain an intended title compound (0.56 g, 34%) as a yellow oil. 0470 1H NMR (CDCl3, 270 MHz) d9.05(1H, dd, J4.1, 1.6 Hz), 8.18(1H, dd, J8.4, 1.6 Hz), 8.02(1H, dd, J7.2, 1.6 Hz), 7.93(1H, dd, J8.4, 1.6 Hz), 7.56(1H, dd, J8.4, 7.2 Hz), 7.45(1H, dd, J8.4, 4.1 Hz), 4.54(2H, dd, J15, 7.3 Hz), 1.45(3H, t, J7.3 Hz)

REFERENCE EXAMPLE 27 0471 Quinoline-8-methanol 80

0472 The ester compound (0.53 g, 2.6 mmol) synthesized in Reference Example 26 was subjected to the same treatment as in Reference Example 4 to obtain an intended title compound (0.34 g, 81%) as white crystals. 0473 Melting point74 to 75 C. 0474 1H NMR (CDCl3, 270 MHz) d8.88(1H, dd, J4.3, 1.9 Hz), 8.20(1H, dd, J8.5, 1.6 Hz), 7.76(1H, dd, J8.1, 1.6 Hz), 7.59(1H, dd, J6.8, 0.8 Hz), 7.51(1H, d, J8.1 Hz), 7.45(1H, dd, J8.1, 4.3 Hz), 5.21(2H, brd.s), 5.10(1H, brd.s)

REFERENCE EXAMPLE 28 0475 Synthesis of methyl 3-(4-benzyloxyphenyl)-3-hydroxy-2-phenoxypropanoate 81

0476 4-Benzyloxybenzaldehyde (3.35 g, 15.8 mmol) and methyl phenoxyacetate (2.62 g, 15.8 mmol) were subjected to the same treatment as in Reference Example 5 to obtain an intended title compound (2.57 g, 43%) as a colorless transparent syrup-like diastereomer mixture. 0477 1H-N.M.R. (CDCl3, 270 MHz)d7.447.31(m, 9H), 7.006.80(m, 5H), 5.175.10(m, 1H), 5.06(s, 2H), 4.76((d, 0.7H, J6.0 Hz), 4.70(d, 0.3 Hz, J5.6 Hz), 3.69(s, 2.1 Hz), 3.61(s, 0.9 Hz), 2.98(d, 0.3 Hz, J5.0 Hz), 2.81(d, 0.7 Hz, J4.3 Hz)

REFERENCE EXAMPLE 29 0478 Synthesis of methyl 3-(4-benzyloxyphenyl)-2-phenoxypropanoate 82

0479 The alcohol compound (2.50 g, 6.61 mmol) synthesized in Reference Example 28 was subjected to the same treatment as in Reference Example 6 to obtain an intended title compound (2.2 g, 92%) as a colorless transparent syrup. 0480 1H-N.M.R. (CDCl3, 270 MHz)d7.437.20(m, 9H), 6.986.81(m, 5H), 5.03(s, 2H), 4.76(dd, 1H, J5.6, 7.7 Hz), 3.70(s, 3H), 3.203.17(m, 2H)

REFERENCE EXAMPLE 30 0481 Synthesis of methyl 3-(4-hydroxyphenyl)-2-phenoxypropanoate 83

0482 The ester compound (2.2 g, 6.07 mmol) synthesized in Reference Example 29 was subjected to the same treatment as in Reference Example 7 to obtain an intended title compound (1.57 g, 95%) as white crystals. 0483 Melting point103 to 105 C. 0484 1H-N.M.R. (CDCl3, 270 MHz)d7.277.14(m, 4H), 6.95(t, 1H, J8.6 Hz), 6.83(dd, 2H, J1.0, 8.6 Hz), 6.75(d, 2H, J8.6 Hz), 4.76(dd, 1H, J5.6, 7.2 Hz), 3.71(s, 3H), 3.193.15(m, 2H)

REFERENCE EXAMPLE 31 0485 Synthesis of 4-methoxymehtyloxybenzaldehyde 84

0486 4-hydroxybenzaldehyde (25.3 g, 0.21 mol) was dissolved in methylene chloride (250 ml). Thereto were added chloromethyl methyl ether (25.0 g, 0.41 mol) and diisopropylethylamine (54 g, 0.41 mol). The mixture was stirred at room temperature for 12 hours. The reaction mixture was poured into water (300 ml). Chloroform (200 ml) was added. The organic layer was separated, dried over anhydrous magnesium sulfate, and subjected to vacuum concentration. The residue was purified by silica gel column chromatography (equivalent product of Merck C-300: 250 g, ethyl acetate:hexane1:4) to obtain an intended title compound (35 g, 100%) as a light brown syrup. 0487 1H-N.M.R. (CDCl3, 270 MHz)d9.90(s, 1H), 7.83 and 7.14(2 d, each 2H, J8.6 Hz), 5.26(s, 2H), 3.49(s, 3H)

REFERENCE EXAMPLE 32 0488 Synthesis of ethyl 3-(4-methoxymethyloxyphenyl)-2-phenylthiopropenoate 85

0489 The aldehyde compound (4.99 g, 30 mmol) synthesized in Reference Example 31 and ethyl phenylthioacetate (4.03 g, 30 mmol) were dissolved in ethanol (60 ml). Thereto was added a 1 N ethanol solution (30 ml) of sodium ethoxide at room temperature. The mixture was heated to 60 C. and stirred for 6 hours. The reaction mixture was allowed to cool and diluted with water (200 ml). Extraction of an intended compound was conducted using ethyl acetate. The organic layer was dried over anhydrous magnesium sulfate and subjected to vacuum concentration. The residue was purified by silica gel column chromatography (NHDM-1020 produced by Fuji Silysia Chemical Ltd.: 100 g, ethyl acetate:hexane1:6) to obtain an intended title compound (2.78 g, 27%) as a light yellow syrup. 0490 1H-N.M.R. (CDCl3, 270 MHz)d8.09(s, 1H), 7.87 and 7.05(2 d, each 2H, J8.5 Hz), 7.307.20(m, 5H), 5.21(s, 2H), 4.11(q, 2H, J7.3 Hz), 3.47(s, 3H), 1.06(t, 3H, 7.3 Hz)

REFERENCE EXAMPLE 33 0491 Synthesis of ethyl 3-(4-hydroxyphenyl)-2-phenylthiopropenoate 86

0492 The ester compound (1.0 g, 2.90 mmol) synthesized in Reference Example 32 was dissolved in methylene chloride (15 ml). Thereto was added a 4 N hydrochloric acid-dioxane solution (5 ml) at room temperature. The mixture was stirred for 2.5 hours. The reaction mixture was poured into a saturated aqueous sodium bicarbonate solution. Thereto was added chloroform. The organic layer was separated and the reaction mixture was subjected to vacuum concentration to obtain an intended title compound (760 mg, 87%) as a light yellow syrup. 0493 1H-N.M.R. (CDCl3, 270 MHz)d8.11(s, 1H), 7.86 and 6.86(2 d, each 2H, J8.5 Hz), 7.207.10(m, 5H), 4.12(q, 2H, J6.9 Hz), 1.08(t, 3H, 6.9 Hz)

REFERENCE EXAMPLE 34 0494 Synthesis of methyl 3-(4-methoxymethyloxyphenyl)-2-phenylthiopropanoate 87

0495 The ester compound (1.72 g, 5 mmol) synthesized in Reference Example 32 was dissolved in methanol (50 ml). Thereto were added magnesium chips (2.43 g, 0.1 mol) at room temperature. The mixture was stirred for 5 hours. The unnecessary matter was removed by filtration. The filtrate was subjected to vacuum concentration. The residue was purified by silica gel column chromatography (equivalent product of Merck C-300: 80 g, ethyl acetate:hexane1:10) to obtain an intended title compound (740 g, 45%) as a light yellow syrup. 0496 1H-N.M.R. (CDCl3, 270 MHz)d7.457.41(m, 2H), 7.327.26(m, 3H), 7.10 and 6.94(2 d, each 2H, J8.9 Hz), 5.14(s, 2H), 3.86(dd, 1H, J6.6, 9.2 Hz), 3.59 and 3.47(2 s, each 3H), 3.14(dd, 1H, J6.6, 12.8 Hz), 3.00(dd, 1H, J9.2, 12.8 Hz)

REFERENCE EXAMPLE 35 0497 Synthesis of methyl 3-(4-hydroxyphenyl)-2-phenylthiopropanoate 88

0498 The methyl ester compound (760 mg, 2.29 mmol) synthesized in Reference Example 34 was treated in the same manner as in Reference Example XX to obtain an intended title compound (660 mg, 100%) as a light yellow syrup. 0499 1H-N.M.R. (CDCl3, 270 MHz)d7.457.40(m, 2H), 7.337.24(m, 3H), 7.04 and 6.73(2 d, each 2H, J8.6 Hz), 4.99(s, 1H), 3.84(dd, 1H, J6.6, 9.2 Hz), 3.58(s, 3H), 3.12(dd, 1H, J9.2, 12.8 Hz), 2.99(dd, 1H, J6.6, 12.8 Hz)

REFERENCE EXAMPLE 36 0500 Synthesis of ethyl 2-ethoxy-3-(3-hydroxyphenyl)propanoate 89

0501 3-Benzyloxybenzaldehyde (8.49 g, 40 mmol) was used as a starting material and the same operation as in Reference Examples 5 to 7 was used, whereby an intended title compound (2.0 g, 21%) was obtained as a colorless transparent syrup. 0502 1H-N.M.R. (CDCl3, 270 MHz)d7.15(t, 1H, J8.0 Hz), 6.826.69(m, 3H), 5.36(s, 1H), 4.18(q, 2H, J7.3 Hz), 4.02(t, 1H, J6.9 Hz), 3.643.56(m, 1H), 3.433.34(m, 1H), 2.96(d, 2H, J6.9 Hz), 1.23(t, 3H, J7.3 Hz), 1.16(t, 3H, J7.3 Hz)

REFERENCE EXAMPLE 37 0503 Synthesis of ethyl 2-ethoxy-3-(3-hydroxy-4-methoxyphenyl)propanoate 90

0504 3-Benzyloxy-4-methoxybenzaldehyde (6.06 g, 25 mmol) was used as a starting material and the same operation as in Reference Examples 5 to 7 was used, whereby an intended title compound (4.56 g, 68%) was obtained as a colorless transparent syrup. 0505 1H-N.M.R. (CDCl3, 270 MHz)d7.25(d, 1H, J8.2 Hz), 6.846.80(m, 2H), 4.14(q, 2H, J7.1 Hz), 3.92(t, 1H, J6.9 Hz), 3.86(s, 3H), 3.333.27(m, 1H), 3.433.34(m, 1H), 2.88(d, 2H, J6.9 Hz), 1.23(t, 3H, J7.3 Hz), 1.12(t, 3H, J7.3 Hz)

REFERENCE EXAMPLE 38 0506 Synthesis of dimethyl (4-hydroxyphenyl)methylenemalonate 91

0507 4-Hydroxybenzaldehyde (12.2 g, 0.1 mol) and dimethyl malonate (13.2 g, 0.1 mol) were suspended in benzene (100 ml). Thereto was added piperidine (1 ml). The mixture was refluxed for 4 hours with heating and then allowed to cool. The resulting crystals were collected by filtration and washed with toluene to obtain an intended title compound (17.7 g, 75%) as milky-white crystals. 0508 Melting point155 to 157 C. 0509 1H-N.M.R. (CDCl3/DMSO-d6, 270 MHz)d9.25(bs, 1H), 7.67(s, 1H), 7.29 and 6.84(2 d, each 2H, J8.6 Hz), 3.86 and 3.82(2 s, each 3H)

REFERENCE EXAMPLE 39 0510 Synthesis of dimethyl (4-hydroxyphenyl)methylmalonate 92

0511 The olefin compound (11.8 g, 50 mmol) synthesized in Reference Example 38 was dissolved in methanol (200 ml). Thereto was added a 10% palladium carbon powder (water content: 50%) (2.4 g, 1 wt. % as Pd). The mixture was stirred vigorously in a hydrogen atmosphere at normal pressure at room temperature for 1.5 hours. The unnecessary matter was removed by filtration using Celite. The filtrate was subjected to vacuum distillation to obtain an intended title compound (12.0 g, 100%) as a colorless transparent syrup. 0512 1H-N.M.R. (CDCl3, 270 MHz)d7.02 and 6.70(2 d, each 2H, J8.5 Hz), 4.90(s, 1H), 3.68(s, 6H), 3.65(t, 1H, J7.0 Hz), 3.10(d, 2H, J7.0 Hz)

REFERENCE EXAMPLE 40 0513 Synthesis of methyl 2-(4-hydroxyphenyl)methyl-3-oxopentanoate 93

0514 4-Hydroxybenzaldehyde (4.0 g, 33 mmol) and methyl 3-oxopentanoate (4.33 g, 33 mmol) were used as starting materials and the same operation as in Reference Examples 38 and 39 was used, whereby an intended title compound (5.0 g, 61%) was obtained as a colorless transparent syrup. 0515 1H-N.M.R. (CDCl3, 270 MHz)d7.01 and 6.81(2 d, each 2H, J8.4 Hz), 5.63(s, 1H), 3.77(t, 1H, J7.7 Hz), 3.68(s, 3H), 3.08(d, 1H, J7.7 Hz), 2.652.10(m, 2H), 0.98(t, 3H, J7.3 Hz)

REFERENCE EXAMPLE 41 0516 Synthesis of 2-(4-benzyloxyphenyl)methylene-3-oxobutanoic acid N-methylamide 94

0517 4-Benzyloxybenzaldehyde (7.22 g, 34 mmol) and a 65% aqueous N-methylacetoacetamide solution (6.02 g, 30 mmol) were treated in the same manner as in Reference Example to obtain an intended title compound (3.27 g, 32%) as a light brown syrup. 0518 1H-N.M.R. (CDCl3, 270 MHz)d7.527.32(m, 8H), 6.97(d, 2H, J9.2 Hz), 5.83(q, 1H, J4.9 Hz), 5.10(s, 2H), 2.92(d, 3H, J4.9 Hz), 2.41(s, 3H)

REFERENCE EXAMPLE 42 0519 Synthesis of 2-(4-hydroxyphenyl)methyl-3-oxobutanoic acid N-methylamide 95

0520 The olefin compound (3.26 g, 10.5 mmol) synthesized in Reference Example 41 was treated in the same manner as in Reference Example 7 to obtain an intended title compound (1.97 g, 85%) as a colorless transparent syrup. 0521 1H-N.M.R. (CDCl3, 270 MHz)d8.53(s, 1H), 6.98 and 6.74(2 d, each 2H, J8.8 Hz), 6.756.70(m, 1H), 3.57(t, 1H, J7.5 Hz), 3.132.97(m, 2H), 2.73(d, 3H, J5.0 Hz), 2.11(s, 3H)

REFERENCE EXAMPLE 43 0522 Synthesis of diethyl (3-hydroxyphenyl)methylenemalonate 96

0523 3-Hydroxybenzaldehyde (12.2 g, 0.1 mol) and diethyl malonate (16.0 g, 0.1 mol) were treated in the same manner as in Reference Example 38 to obtain an intended title compound (17.2 g, 65%) as light brown crystals. 0524 Melting point72 to 74 C. 0525 1H-N.M.R. (CDCl3, 270 MHz)d7.68(s, 1H), 7.22(t, 1H, J8.0 Hz), 6.96(d, 1H, J8.0 Hz), 6.92(s, 1H), 6.90(d, 1H, J8.0 Hz), 6.24(s, 1H), 4.35 and 4.31(2q, each 2H, J6.9 Hz), 1.361.24(m, 6H)

REFERENCE EXAMPLE 44 0526 Synthesis of diethyl (3-hydroxyphenyl)methylmalonate 97

0527 The olefin compound (13.2 g, 50 mmol) synthesized in Reference Example 43 was treated in the same manner as in Reference Example 39 to obtain an intended title compound (13.5 g, 100%) as a colorless transparent syrup. 0528 1H-N.M.R. (CDCl3, 270 MHz)d7.13(t, 1H, J8.0 Hz), 6.766.67(m, 3H), 4.16(q, 4H, J7.3 Hz), 3.65(t, 1H, J8.0 Hz), 3.17(d, 2H, J8.0 Hz), 1.21(t, 6H, J7.3 Hz)

REFERENCE EXAMPLE 45 0529 Synthesis of diethyl (3-hydroxy-4-methoxyphenyl)methylenemalonate 98

0530 3-Hydroxy-4-methoxybenzaldehyde (7.61 g, 50 mmol) and diethyl malonate (9.61 g, 60 mol) were treated in the same manner as in Reference Example 38 to obtain an intended title compound (11.8 g, 80%) as milky-white crystals. 0531 Melting point81 to 83 C. 0532 1H-N.M.R. (CDCl3, 270 MHz)d7.61(s, 1H), 7.056.99(m, 2H), 6.83(d, 1H, J8.2 Hz), 5.65(s, 1H), 4.37 and 4.29(2q, each 2H, J7.3 Hz), 3.92(s, 3H), 1.361.30(m, 6H)

REFERENCE EXAMPLE 46 0533 Synthesis of diethyl(3-hydroxy-4-methoxyphenyl)methylmalonate 99

0534 The olefin compound (5.89 g, 20 mmol) synthesized in Reference Example 45 was treated in the same manner as in Reference Example 39 to obtain an intended title compound (5.63 g, 950%) as a colorless transparent syrup. 0535 1H-N.M.R. (CDCl3, 270 MHz)d6.786.66(m, 3H), 5.59(s, 1H), 4.14(q, 4H, J7.3 Hz), 3.59(t, 1H, J8.0 Hz), 3.12(d, 2H, J8.0 Hz), 1.22(t, 6H, J7.3 Hz)

TEST EXAMPLE 1 0536 In-vitro Evaluation of PPAR and PPAR Agonist Activities 0537 It was proved by the following experiments that the compounds represented by formulae (1) and (2) according to the present invention have the activity to control PPAR receptor. 0538 Measurement of PPAR Agonist Activity and PPAR Agonist Activity 0539 1. Materials for Assay of Luciferase Using Human PPAR and PPAR Receptors 0540 The entire procedure was carried out according to the fundamental methods of genetic engineering and the ordinary method in the yeast one-hybrid or two-hybrid system was applied. 0541 PGL2-UAS5-TK-luc was prepared as a reporter plasmid carrying a response sequence of Gal4 protein as a basic transcription factor of yeast, an enhancer sequence with five repeat part of UAS, a luciferase gene (luc) under the control of timidine kinase (TK) promoter. Specifically, a DNA fragment encoding a TK promoter (105/51) on the downstream side of an enhancer sequence comprising two time repeat of UAS was amplified by PCR using pRL-TK carrying a TK promoter (Promega, Trade name: Catalogue No. E2241) as the template and the primers: 0542 5 primer (SEQ ID NO: 1) 0543 5-GCTAGATCT(CGACGGAGTACTGTCCTCCGAGCT)2 CGAGGCCCCGCCCAGC GTCTTGTC-30544 3 primer (SEQ ID NO:2) 0545 5-TTAAGCTTCTGCGGCACGCTGTTGACGCTGTTAAGCGGGTC GCTGCAGGG-3. 0546 After the fragment was cleaved with XhoI-Hind III, pGL2-UAS2-TK-luc was obtained by inserting the resultant fragment into the XhoI-Hind III site located on the upstream side of a luciferase structural gene on pGL2-Basic vector (Promega, Trade name: Catalogue No. E1641). 0547 After cleavage of a synthetic DNA as an enhancer sequence comprising three time repeat of Gal4 response sequence (SEQ ID NO: 3): 5-ATTGGTAC(CGACGGAGTACTGTCCTCCGAGCT)3 AGATCTCGAC) using KpnI and BgIII was carried out, pGL2-UAS5-TK-luc was prepared by inserting the resulting fragment into the KpnI-BgIIIb site of pGL2-UAS2-TK-luc. 0548 A vector for expression of a chimera receptor protein, in which a ligand binding region of an internuclear receptor human PPAR or PPAR receptor was fused with the carboxyl terminal of a DNA binding region of yeast Ga14 protein, was prepared as follows: 0549 The structural gene of pSG5 (STRATAGENE, Trade Name: Catalogue No. 216201) as the basic expression vector was changed for the chimera receptor except that the promoter-enhancer region was maintained as it was. 0550 The DNA encoding the ligand binding region of the human PPAR or PPAR receptor was fused on the downstream side of the DNA encoding the DNA binding region and the amino acid sequence from 1 to 147 positions of Ga14 protein so that their reading frames were fitted and the resulting fused DNA was inserted into pSG5 (trade name) on the down stream side of the promoter-enhancer region. In this step, the DNA sequence was arranged so that a signal for transfer into the nucleus (Ala Pro Lys Lys Lys Arg Lys Val Gly (SEQ ID: No: 4) derived from SV-40T antigen was located on the amino terminal of the ligand binding region of PPAR or PPAR receptor in order to localize the chimera receptor in the nucleus. 0551 Based on comparison of the human PPAR receptors described in R. Mukherjee et al., see J. Steroid Biochem. Molec. Biol., Vol. 51, p157 (1994) and M. E. Green et al., see Gene Expression, Vol. 4, p281 (1995)), as the structural gene part used for the ligand binding region PPAR or PPAR, the human PPAR ligand binding region: Ser167-Tyr468; and the PPAR ligand binding region: Ser176-Tyr478 were used, which had the same sequences corresponding to Ser204-Tyr506 for human PPAR1 receptor and human PPAR2, respectively. 0552 In order to monitor influence against the basic transcription, an expression vector was prepared which carried a DNA encoding only the DNA binding region and the amino acid sequence from 1 to 147 position of Ga14 protein defective in its PPAR ligand binding region and a signal for transfer into the nucleus of SV-40T-antigen. 0553 2. Assay of Luciferase Using Human PPAR or PPAR Receptor 0554 CV-1 cells used as a host cell were cultivated according to an ordinary method. Specifically, a fetal bovine serum (Intergent, Catalogue No. 1020-90) was added to a Dulbecco's modified Eagle's medium (DMEM) so that the final concentration became 10%. Further, penicillin G (50 U/ml) and streptomycin sulfate (50 g/ml) were added. Cultivation was conducted in the resulting medium in a 5% carbon dioxide gas at 37 C. 0555 On the previous day of transfection, the cells were planted into a 24-well plate in an amount of 1.5105 cells/well, and transfection was conducted using Lipofect AMINE (trade name, GIBCOBRL, Catalogue No. 26300-61). Specifically, to a serum-free medium, OPti-MEM (trade name, GIBCOBRL, Catalogue No. 31985-070) (40 l/well) were added a reporter plasmid (100 ng/well), a Ga14-PPAR expression vector (12.5 ng/well), pRL-TK (trade name) (200 ng/well) as an internal control, pGEM-3Zf () (trade name, Promega, Catalogue No. p2271) (287.5 ng/well) as a carrier DNA and Lipofect AMINE (trade name, GIBCOBRL, Catalogue No. 26300-61) (2.6 l/well), followed by thorough mixing. Then, Opti-MEM (trade name) (170.2 l/well) was added. The resulting mixture was added to the cells washed with PBS (phosphate buffered saline) and Opti-MEM (trade name). Cultivation was conducted at 37 C. for 16 hours. Then, the medium was substituted with DMEM-10% active carbon-dextran-treated fetal bovine serum (trade name, HyClone, Catalogue No. SH30068.03) containing a present compound; cultivation was conducted at 37 C. for 24 hours to fuse the cells; and luciferase activity was measured according to an ordinary method. 0556 Regarding the PPAR agonist activity, a luciferase activity was taken as 100 which appeared when there was added 10 M of a positive control compound Wy-14,643 capable of significantly activating the transcription of luciferase gene against PPAR see Cell, Vol. 83, p813 (1995); J. Biol. Chem., Vol. 270, p12953 (1995); Proc. Natl. Acad. Sci. USA, Vol. 94, p4312 (1997); J. Biol. Chem., Vol. 272, p3406 (1997); and a luciferase activity which appeared when there was added a present compound in an amount of 0.1, 1.0 or 10 M, was shown in Table 1, as a relative activity to the above. 0557 Regarding the PPAR agonist activity, a luciferase activity was taken as 100 which appeared when there was added 1 M of a positive control compound Pioglitazone capable of significantly activating the transcription of luciferase gene against PPAR see Cell, Vol. 83, p803 (1995) and J. Biol. Chem., Vol. 270, p12953 (1995); and a luciferase activity which appeared when there was added a present compound in an amount of 0.1, 1.0 or 10 M, was shown in Table 2, as a relative activity to the above. 1TABLE 1PPAR agonist activityRelative activityCompound No.0.1 M1 M10 MExample 1 (101)0.20.928.7Example 2 (61)NT10.424.6Example 3 (102)0.40.98.5Example 4 (104)0.30.30.3Example 5 (71)0.30.528.4Example 6 (67)5.747.174.0Example 7 (63)0.44.564.4Example 8 (65)0.30.31.5Example 9 (97)0.30.423.0Example 10 (32)0.20.350.1Example 11 (99)25.264.368.6Example 12 (85)0.20.36.4Example 13 (76)0.30.941.1Example 14 (86)0.30.32.1Example 15 (82)0.30.35.0Example 16 (32)0.30.445.2Example 18 (112)0.30.30.3Example 19 (108)0.30.30.6NT Not tested.

0558

2TABLE 2PPAR agonist activityRelative activityCompound No.0.1 M1 M10 MExample 1 (101)98.6127.1102.3Example 2 (61)85.0114.2NTExample 3 (102)74.1114.5108.3Example 4 (104)0.41.114.9Example 5 (71)0.30.411.6Example 6 (67)122.1140.3124.9Example 7 (63)13.563.3114.1Example 8 (65)1.313.0107.2Example 9 (97)0.616.8110.1Example 10 (32)1.020.8123.9Example 11 (99)75.2114.7105.6Example 12 (85)1.260.4111.4Example 13 (76)103.9139.6130.5Example 14 (86)19.676.0132.3Example 15 (82)52.3132.8124.6Example 16 (32)1.671.8127.4Example 18 (112)0.522.289.9Example 19 (108)25.283.597.9Example 20 (114)9.391.0109.5Example 21 (118)1.41.922.4Example 22 (120)3.562.3107.9Example 23 (137)2.830.563.1Example 24 (141)0.81.29.4Example 25 (144)0.71.96.2Example 26 (147)0.13.712.8Example 27 (128)1.22.142.5Example 28 (129)1.32.114.7

TEST EXAMPLE 2 0559 Test for in-vitro Evaluation of the Compound's Action of Removing the hTNF's Inhibition for Sugar Intake Induced by Insulin Stimulus 0560 It was proven by the following experiment that the compound represented by the formula (1) according to the present invention has an action of removing the hTNF's inhibition for glucose intake induced by insulin stimulus. 0561 The present compound's action of removing the hTNF 's inhibition for glucose intake induced by insulin stimulus in 3T3-L1 lipocytes was investigated by measurement of glucose concentration in medium. 0562 Specifically, mouse 3T3-L1 fibroblasts (produced by Dainippon Pharmaceutical Co., Ltd.) were suspended in a Dulbecco's modified Eagle's medium (DMEM) containing 10% of a bovine serum and planted in a 24-well collagen plate; and cultivation was conducted until the cells became confluent. Cultivation was continued for a further 2 days (the day of cultivation completion was taken as the 0 (zero) day of differentiation induction). Then, the medium was substituted with a differentiation induction medium (a DMEM containing 10% of a fetal bovine serum, 0.5 mM of 3-isobutyl-1-methyl-xanthine, 0.25 M of dexamethasone and 1 g/ml of insulin), followed by cultivation for 40 hours. On the second day of differentiation induction, the medium was substituted with a DMEM containing 10% of a fetal bovine serum and 1 g/ml of insulin and cultivation was conducted. On the 4th day of differentiation induction, the medium was substituted with a DMEM containing 10% of a fetal bovine serum and 50 ng/ml of insulin and cultivation was conducted. On the 7th day of differentiation induction when the cells differentiated sufficiently into lipocytes, a compound of the present invention was added to a DMEM containing 10% of a fetal bovine serum, 50 ng/ml of insulin and 5 ng/ml of hTNF and cultivation was conducted therein. The present compound was beforehand dissolved in DMSO and then added to the medium so that the final concentration of DMSO became 0.1%. On the 9th day of differentiation induction, the medium was substituted with a medium containing the present compound, having the same composition as in the 7th day of differentiation induction. In the above cultivations, 50 U/ml of penicillin and 50 g/ml of streptomycin sulfate were added to each medium in order to avoid contamination and each cultivation was conducted in a 5% carbon dioxide gas at 37 C. 0563 On the 11th day of differentiation induction, the medium was substituted with a DMEM containing 2% of a bovine serum albumin (BSA), in order to remove the influence of serum, and cultivation was conducted for 4 hours. The medium was removed and the cells were washed with a Krebs-Ringer buffer (1.2 mM KH2PO4, 4.7 mM KCl, 118 mM NaCl, 25 mM NaHCO3, 2.5 mM CaCl2, pH 7.4) containing 0.1% of the BSA and 180 mg/l of glucose. Then, to each well was added 300 l of Krebs-Ringer buffer containing 0.1% of the BSA, 180 mg/l of glucose and 0.5 ng/ml of insulin, and cultivation was conducted in a 5% carbon dioxide gas at 37 C. for 3 hours. 0564 The glucose concentration in supernatant liquid of medium, which is an indication of sugar intake, was measured by using Glucose CII Test Wako (produced by Wako Pure Chemicals Industries, Ltd.). 0565 The activity (the action of removing the hTNF's inhibition of sugar intake) of the present compound (10 M) was shown as a relative value when the activity of a positive control compound (Pioglitazone 10 M) was taken as 100. The results are shown in Table 3. 3TABLE 3Compound's removal of hTNF's inhibition for glucosemetabolismCompound No.Relative activityExample 1 (101)NTExample 2 (61)83Example 3 (102)NTExample 4 (104)NTExample 5 (71)67Example 6 (67)68Example 7 (63)93Example 8 (65)91Example 9 (97)NTExample 10 (32)NTExample 11 (99)NTExample 12 (85)NTExample 13 (76)81Example 14 (86)69Example 15 (82)82Example 16 (32)70Example 17 (106)NTExample 18 (112)107Example 19 (108)77Example 20 (114)85Example 21 (118)51Example 22 (120)89Example 23 (137)16Example 24 (141)48Example 25 (144)97Example 26 (147)85Example 27 (128)74Example 28 (129)23NT Not tested

TEST EXAMPLE 3 0566 Test for in-vitro Evaluation of the Action of Inhibiting the Production of Tumor Necrosis Factor (TNF) Using Lipocytes (Derived from 3T3-L1) 0567 It was proved by the following experiment that a compound represented by the formula (1) according to the present invention has an action for inhibiting the production of TNF. 0568 A luciferase gene was bonded to the downstream side of human TNF transcription-controlling region. The resulting material was stably inserted into the chromosomes of 3T3-L1 cells. The thus-obtained cell strain No. 46 was used for evaluation. 0569 The cell strain No. 46 was cultivated according to an ordinary method. Specifically, a bovine serum (Cell Culture Technology, Catalogue No. CC017-502) was added to a Dulbecco's modified Eagle's medium (DMEM) so that the final concentration became 10%. Further, 50 U/ml of penicillin G, 50 ug/ml of streptomycin sulfate and 0.4 mg/ml of G418 were added. In the resulting medium was conducted cultivation in a 5% carbon dioxide gas at 37 C. 0570 The cell strain No. 46 was planted into a PLL (poly L-lysine)-coated 48-well plate. When the cell strain reached confluence and then at least two days passed, the medium was substituted with the above medium containing 9 ng/m of hTNF (Genzyme) and an activity for TNF transcription was induced. hTNF was added and, simultaneously therewith, a compound of the present invention was added so that the final concentration became 10 M. 24 hours later, the cells were observed by a microscope. Then, the cells were fused and the luciferase activity was measured according to an ordinary method. 0571 Regarding the activity for TNF transcription, the luciferase activity when DMSO was added in place of the compound, was taken as 100; and the relative activity when 10 uM of the present compound was added, was shown in Table 1. Incidentally, the relative luciferase activity when no hTNF was added, was 40%. The results of evaluation are shown in Table 4. 4TABLE 4Activity for TNF transcriptionRelative activityCompound No.10 MExample 3 (102)71.7Example 4 (104)64.0Example 24 (141)71.6Example 26 (147)59.0

TEST EXAMPLE 4 0572 Test for in-vivo Evaluation of the Activities for Blood Sugar Reduction and Lipid Reduction Using Diabetes Model Mice (KKAy Mice) 0573 Type 2 diabetes mice KK-Ay/Ta Jci (male, Clea Japan, Inc., 10-week old) put in cages were used (each cage contained 5 mice). In the morning of the 1st day of test start, a blood was collected from the orbital vein of each mouse. The blood sugar value in the blood was measured by subjecting the blood to deproteinization using perchloric acid, subjecting the resulting material to centrifugation, and subjecting the resulting supernatant liquid to a new blood sugar test (Boehringer Mannheim). Further, the blood was subjected to centrifugation to obtain a plasma and the triglyceride concentration and free fatty acid concentration in the plasma were measured using Triglyceride E-Test Wako and NEFA-C Test Wako (Wako Pure Chemical Industries, Ltd.), respectively. Grouping was made so that the blood sugar values in individual groups became the same. Then, an Example 2 compound (exemplary compound No. 61) was suspended in a 0.5% aqueous CMC solution and administered orally one time per day for 4 days. In the 5th day of test, blood collection was made to measure blood sugar value, triglyceride concentration and free fatty acid concentration. Incidentally, a group to which only the 0.5% aqueous CMC solution was administered, was used as a control group; and Pioglitazone was used in a positive control group. The reduction in parameter in each group was calculated using the following formula. The results are shown in Table 5.

Reduction (%)1(parameter of 5th day in each group)/(parameter of 1st day in each group)100

0574

5TABLE 5Results of in-vivo evaluation of reduction in blood sugarand reduction in lipid, using KKAy miceReductionReduction inReduction inCompoundDosein bloodtriglyceridefree fattygroup(mg/kg)sugar (%)(%)acid (%)Control9813groupExample 230505746Pioglita-30286049zone

0575 Industrial Applicability 0576 The compound of the present invention is a novel substance and, as shown in Examples and Test Examples, allows PPAR or (which is an intranuclear transcription factor) to function strongly. Further, the present compound is low in toxicity and is therefore expected to be used as a preventive or therapeutic agent against various diseases related to PPAR or .