The human induced pluripotent stem cell line can be prepared by transfection with a vector into which a fluorescent protein is inserted using sgRNA targeting the genes represented by SEQ. ID. NO: 1 to NO: 3, but is not limited thereto.

In a specific embodiment of the present invention, the present inventors designed a targeting vector to knock-in a fluorescent protein into the cytochrome P450 locus in fibroblast-derived human induced pluripotent stem cells, and prepared a targeting vector using three single-guide RNAs (sgRNA) and transfected the human induced pluripotent stem cell line to establish a clone of a human induced pluripotent stem cell line transformed with fluorescent protein-tagged cytochrome P450 (see FIG. 1). As a result of confirming that the established transgenic human-induced pluripotent stem cell lines maintain the characteristics of human-induced pluripotent stem cells, it was confirmed that the pluripotent markers such as NANOG, OCT4, SOX2, TRA-1-60 and TRA-1-81 were normally expressed in human-induced pluripotent stem cells (see FIG. 2a). It was also confirmed that the possibility of cell differentiation into three germ layers through EB formation analysis (see FIGS. 2b and 2c). In addition, as a result of karyotype analysis of the prepared transgenic human induced pluripotent stem cell line, it was confirmed that the karyotype was normal (see FIG. 2d).

Therefore, it was confirmed that the human induced pluripotent stem cell line transformed with fluorescent protein-tagged cytochrome P450 prepared in the Example of the present invention maintained the characteristics of human induced pluripotent stem cells.

In addition, the present inventors confirmed the function of the hepatocytes differentiated from the human induced pluripotent stem cell line transformed with fluorescent protein-tagged cytochrome P450 prepared in the Example of the present invention. As a result, it was confirmed that the mRNA expression and protein expression of the hepatocyte-specific marker genes were increased (see FIGS. 4a to 4c), and albumin-positive hepatocytes were more than 96%, and it was confirmed that they were successfully differentiated into hepatocytes through albumin secretion detection and low-density lipoprotein-uptake analysis (see FIGS. 4d to 4g).

The present inventors confirmed the expression of fluorescent protein-tagged cytochrome P450 protein in the hepatocytes differentiated from the human induced pluripotent stem cell line transformed with fluorescent protein-tagged cytochrome P450 protein prepared in the Example of the present invention. As a result, it was confirmed that the fluorescent protein and cytochrome P450 were expressed at similar levels and were expressed at the same location (see FIG. 5).

The present inventors confirmed whether a signal of a fluorescent protein could be induced by an AHR agonist. As a result, it was confirmed that the intensity of the fluorescent protein was increased in proportion to the activity of cytochrome P450 when the hepatocytes differentiated from the human induced pluripotent stem cell line transformed with fluorescent protein-tagged cytochrome P450 were treated with a known AHR agonist (see FIGS. 6 to 7).

From the above results, it was confirmed that the hepatocytes differentiated from the human induced pluripotent stem cell line transformed with fluorescent protein-tagged cytochrome P450 of the present invention can be used for screening of an AHR modulator.

In addition, the present invention provides an AHR modulator screening method comprising the following steps:

1) contacting a test substance to the human induced pluripotent stem cell line transformed with fluorescent protein-tagged cytochrome P450 protein;

2) measuring the signal intensity of the fluorescent protein in the human induced pluripotent stem cell line transformed with fluorescent protein-tagged cytochrome P450 protein contacted with the test substance; and

3) selecting a test substance that changes the signal intensity of the fluorescent protein compared to a control sample.

The control sample of step 3) can be BaP or TCDD, but is not limited thereto.

The AHR modulator screening method can be performed in a high content screening system (HCS).

In a specific embodiment of the present invention, the present inventors set up an automatic analysis protocol with a high-content screening (HCS) device using the hepatocytes derived from the prepared human-induced pluripotent stem cell line transformed with fluorescent protein-tagged cytochrome P450 and screened an AHR modulator. As a result, three compounds that increase the fluorescent protein expression and two compounds that decrease the fluorescent protein expression were selected (see FIGS. 8 to 10).

In addition, the present inventors compared the hepatocytes derived from the prepared human induced pluripotent stem cell line transformed with fluorescent protein-tagged cytochrome P450 and hPH and HepG2 cell lines. As a result, it was confirmed that the hepatocytes derived from the prepared human induced pluripotent stem cell line transformed with fluorescent protein-tagged cytochrome P450 could be used as living conditions, and thus more suitable for the AHR screening method than hPH and HepG2 cells (see FIGS. 11 to 13).

Currently commercially available AHR reporter cell lines are based primarily on a luciferase reporter system under the control of a CYP1A1 promoter in several malignant cell lines such as HepG2 (liver cancer cells) and HT29 (colorectal adenocarcinoma cells). Treatment of BaP in HepG2 cells causes undesirable gene elevation and pathway activation. Human primary hepatocytes (hPH) show an excellent effect in terms of response to BaP, but cell supply is limited as cells are no longer divided. On the other hand, the transformed human induced pluripotent stem cell line-derived hepatocytes of the present invention have the advantages of the induced pluripotent stem cells themselves, which can provide cells with potential for future cell differentiation and provide various cell types.

Although a luciferase-based AHR reporter human induced pluripotent stem cell line (hiPSCs) has also been reported (Smith, B W, Stanford, E A, Sherr, D H, and Murphy, G J (2016) Genome Editing of the CYP1A1 Locus in iPSCs as a Platform to Map AHR Expression throughout Human Development Stem Cells Int 2016, 2574152), the luciferase reporter system entails cell sacrifice to investigate AHR activity, while the reporter system of the present invention has the advantage of exhibiting AHR activity in living cells through the fluorescence level of CYP1A1-mCherry. As a result, it is possible to track not only the concentration of the drug but also the reaction kinetics according to the drug treatment time in the same cell, providing additional information for understanding the drug mechanism.

Hereinafter, the present invention will be described in detail by the following examples.

However, the following examples are only for illustrating the present invention, and the contents of the present invention are not limited thereto.

1. Culture of Human Induced Pluripotent Stem Cells and Differentiation into Hepatocytes

Human-induced pluripotent stem cells (hiPSC) derived from human skin fibroblasts were used in knock-in experiments as the control human-induced pluripotent stem cells (hiPSC).

First, human-induced pluripotent stem cells derived from human skin fibroblasts were maintained in mTeSR-E8 medium containing Vitronectin XF™ (Stem Cell Technologies, Vancouver, Canada) and dissociated every 3 or 4 days using 0.5 mM EDTA in DPBS (Dulbecco's Phosphate-Buffered Saline).

The following experiment was performed to differentiate the cultured hiPSCs into hepatocytes. Specifically, hiPSCs were plated on Matrigel® (Corning, Tewksbury, Mass., USA) coated culture dishes and cultured in mTeSR™-E8™ (Stem Cell Technologies) for 1 day. For the differentiation of definitive endoderm (DE), hiPSCs were cultured for 1 day in RPMI-1640 containing 0.5 mg/ml of bovine serum albumin (BSA), 2% B27 (Thermo Fisher Scientific, Waltham, Mass., USA), 50 ng/ml of activin A (Peprotech, Rocky Hill, N.J., USA) and 1 mM sodium butyrate (Sigma-Aldrich, St. Louis, Mo., USA). Then, cell culture was continued for 4 days in the same medium in which the concentration of sodium butyrate was reduced. Next, DE cells were differentiated into hepatic endodermal cells by culturing in RPMI-1640 containing 0.5 mg/ml of BSA, 2% B27, 10 ng/ml of fibroblast growth factor 4 (FGF4, Peprotech) and 10 ng/ml of hepatocyte growth factor (HGF, Peprotech) for 5 days. Liver maturation was induced by culturing the cells in a hepatocyte culture medium (HCM; Lonza, Basel, Switzerland) supplemented with 10 ng/ml of FGF4, 10 n/ml of HGF, 10 ng/ml of oncostatin M (Peprotech) and 0.1 μM dexamethasone (Sigma-Aldrich) for 7 days. The culture medium was replaced every day.

For the formation of embryoid body (EB), CYP1A1-mCherry hiPSCs were dissociated using 0.5 mM EDTA and seeded on AggreWell™ 800 plates (Stem Cell Technologies). On the next day, the cell aggregate was transferred to low adhesion plates and cultured in mTeSR™-E8™ medium for 7 days. The formed embryoid body was cultured on a Matrigel®-coated plate for an additional 7 days prior to analysis.

Human primary hepatocytes (Corning, Donor No. 303) were plated on a collagen I-coated culture plate using Gentest™High Viability CryoHepatocyte Recovery kit (Corning) according to the manufacturer's instructions, and an experiment was performed 24 hours later. HepG2 cells were cultured in Eagle's Minimum Essential Medium (EMEM; Biowest, Nuaille, France) containing 10% fetal bovine serum (FBS; Thermo Fisher Scientific).

2. mCherry Knock-In Using CRISPR-Cas9 System

Human codon-optimized SpCas9 and chimeric guide RNA expression plasmid (pX330-U6-Chimeric_BB-CBh-hSpCas9; Addgene, Watertown, Mass., USA) were used to target vector construction. A single guide RNA (sgRNA) was constructed using an online CRISPR design tool at the intron site of the target gene. The sgRNA was selected using the lowest off-target effect. The target sequences of the three single guide RNAs (sgRNAs) are shown in Table 1 below. The following experiment was performed according to the target sequence cloning protocol of the Zhang's laboratory.

TABLE 1

PCR

SEQ.

analy-

ID.

sis

Locus
sgRNA
Score
Target site
colony
Freeze
NO:

E6-
Guide
78
GCATTGATCC
GGG
6 /13
5
1

E7_
#1

TCCTGTCCAT

intron

E4-
Guide
73
TAGGTAGTGG
AGG
12 /29
9
2

E5_
#4-2

CTCCCTTCAA

intron
Guide
73
CTGGCACTGA
GGG
4 /9
3
3

#5_

CCCCTTTGAA

Reverse

The pMCDT-A vector was used as the backbone of the targeting vector. The human CYP1A1 gene was amplified by polymerase chain reaction (PCR) using genomic DNA extracted from hiPSCs. 5′ and 3′ homologous arms were targeted 1.2 kb upstream and 0.93 kb downstream of the stop codon in CYP1A1, respectively. mCherry and PGKneo were amplified by PCR from the plasmids containing them. After sequence confirmation, each fragment was ligated using a T4 DNA ligase (Promega, Madison, Wis., USA). 5′ homologous arms, mCherry, PGKneo and 3′ homologous arms were ligated using SmaI, HindIII and SalI, respectively. The resulting final fragment was inserted into pMCDT-A vector using NotI and XhoI. For transfection, hiPSCs at passage 28 were prepared as single cells (2.5×10⁷cells/ml) by dissociation with 0.5 mM EDTA in DPBS. 4 μg of the targeting vector and 1 μg of the Cas9 vector were added to the cell suspension and electroporation was performed under the conditions of 1600 V, 20 ms, and 1 pulse using NEON® (Invitrogen, Carlsbad, Calif., USA) transfection system. After the electroporation, cells were seeded on a Matrigel®-coated 48-well plate at the density of 1,000 viable cells/well. The cells were expanded for 48 hours and then selected with 50 μg/ml of Geneticin (G418 sulfate, Gibco) for 2 weeks. Thereafter, drug-resistant clones were manually selected, and expansion and further experiments were performed. For the analysis of the present invention, CYP1A1-mCherry hiPSCs from passages 29 to 40 were used.

3. Characteristic Analysis of CYP1A1-mCherry hiPSC Line

To confirm the genome targeting efficiency, T7 endonuclease I analysis was performed according to the manufacturer's protocol.

Specifically, genomic DNA was extracted from hiPSCs transfected with or without sgRNA using G-spin™Total Genomic DNA Extraction Kit (Intron Biotechnology, Gyeonggi, Korea). Then, a 500 bp fragment containing the sgRNA binding site was amplified by PCR. After purifying the PCR product using MEGAquick-spin™Plus Total Fragment DNA purification kit (Intron Biotechnology), the product was denatured and annealed and then digested with T7 endonuclease I (NEB, Ipswich, Mass., USA). The digested DNA fragments were analyzed by agarose gel electrophoresis. Knock-in was confirmed by PCR and DNA sequencing of the targeted integration site. Genomic DNA was isolated from drug-resistant clones using a G-DEX genomic DNA extraction kit (Intron Biotechnology), and 50 ng of the isolated DNA was amplified using EX Taq® polymerase (Takara Bio, Shiga, Japan) with the primers listed in Table 2.

To analyze the karyotype of CYP1A1-mCherry hiPSC, G-banding karyotype analysis (GenDix, Seoul, Korea) was performed with a band resolution of 550 for 20 single clones.

TABLE 2

SEQ.

ID.

Primer
Sequence (5′→3′)
NO:

CYP1A1 forward
AGGCTTTTACATCCCCAAGG
4

CYP1A1 reverse
TTGTCGATAGCACCATCAGG
5

mCherry forward
GTGAGCACTTCCAAATGCAGC
6

mCherry reverse
CCTTGAAGCGCATGAACTCCT
7

PAX6 forward
GTGTCCAACGGATGTGTGAG
8

PAX 6 reverse
CTAGCCAGGTTGCGAAGAAC
9

OTX2 forward
TGCAGGGGTTCTTCTGTGAT
10

OTX2 reverse
AGGGTCAGAGCAATTGACCA
11

α-SMA forward
TGCTCTGGGTTCGTCAGAGTC
12

α-SMA reverse
CAGGCAAGTCACTGTGTGGC
13

EOMES forward
AGGCGCAAATAACAACAACAC
14

EOMES reverse
ATTCAAGTCCTCCACGCCATC
15

Brachyury
GCGGGAAAGAGCCTGCAGTA
16

forward

Brachyury
TTCCCCGTTCACGTACTTCC
17

reverse

FOXA2 forward
ATGCACTCGGCTTCCAGTAT
18

FOXA2 reverse
CACGTACGACGACATGTTCA
19

GATA4 forward
TCCAAACCAGAAAACGGAAG
20

GATA4 reverse
CTGTGCCCGTAGTGAGATGA
21

SOX17 forward
CAGAATCCAGACCTGCACAA
22

SOX17 reverse
GCGGCCGGTACTTGTAGTT
23

ALB forward
GAGACCAGAGGTTGATGTGATG
24

ALB reverse
AGTTCCGGGGCATAAAAGTAAG
25

AAT forward
GAAGTCAAGGACACCGAGGA
26

AAT reverse
GCTGGCAGACCTTCTGTCTT
27

TDO2 forward
CAAATCCTCTGGGAGTTGGA
28

TDO2 reverse
GTCCAAGGCTGTCATCGTCT
29

HNF4A forward
CGAGCAGATCCAGTTCATCA
30

HNF4A reverse
TCACACATCTGTCCGTTGCT
31

G6Pase forward
TCAACCTCGTCTTTAAGTGGATTC
32

T

G6Pase reverse
AGTATACACCTGCTGTGCCC
33

TAT forward
GCTTCCTCAAGTCCAATGCT
34

TAT reverse
CTGTGATGACCACTCGGATG
35

TTR forward
ACCGGTGAATCCAAGTGTCC
36

TTR reverse
GGTTTTCCCAGAGGCAAATGG
37

AFP forward
AGCTTGGTGGTGGATGAA
38

AFP reverse
TCTGCAATGACAGCCTCAAG
39

4. Flow Cytometry

HLCs derived from CYP1A1-mCherry hiPSCs were dissociated with 0.5 mM EDTA and washed with DPBS containing 10% FBS. The dissociated cells were fixed and permeabilized with Foxp3 fixation/permeabilization solution (eBioscience, San Diego, Calif., USA) for 1 hour at room temperature (RT). The cells were incubated with 1 μg of mouse anti-ALB primary antibody (R & D Systems, Minneapolis, Minn., USA) for 1 hour and then tagged with fluorescein-conjugated secondary antibody for 1 hour on ice. Flow cytometry was performed using a FACSCalibur™ flow cytometer (BD Biosciences, San Jose, Calif., USA) and data was analyzed with FlowJo® software.

5. Hepatic Functional Tests

In the case of enzyme-linked immunosorbent assay (ELISA), the culture supernatant was collected 24 hours after the medium was replaced, and the amount of the secreted albumin was measured using a human albumin ELISA quantification kit (Bethyl Laboratories, Montgomery, Tex., USA) according to the manufacturer's protocol. The amount of the secreted albumin was measured using 100 μl of the culture supernatant from an independent culture dish, calculated according to each standard curve, and normalized to protein content. The protein content was determined using a Bio-Rad protein analysis kit (Bio-Rad, Hercules, Calif., USA). For acetylated-low density lipoprotein lipoprotein (Ac-LDL) absorption analysis, cells were cultured with 10 μg/ml of 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine-tagged Ac-LDL (Life Technologies, Carlsbad, Calif., USA) for 5 hours. Red fluorescence was visualized with a fluorescence microscope.

6. Immunocytochemical Analysis

Cells were fixed using 4% formaldehyde (Sigma-Aldrich) for 30 minutes at room temperature, and then washed three times with PBS containing 0.1% Tween 20 (PBST) for 10 minutes. Then, the samples were permeabilized for 15 minutes in PBS containing 0.1% Triton X-100 (Sigma-Aldrich), and blocked with 4% normal goat serum (Jackson ImmunoResearch, West Grove, Pa., USA) for 1 hour at RT. The cells were diluted in PBS containing 4% normal sheep serum (for SOX17) or normal goat serum (for others) and then cultured overnight at 4° C. with the following primary antibodies: rabbit anti-CYP1A1 (1:200; Abcam, Cambridge, UK), mouse anti-mCherry (1:200), rabbit anti-AAT (1:200), mouse anti-HNF4A (1:200; Abcam), rabbit anti-ALB (1:50), rabbit anti-AFP (1:200; Dako, Glostrup, Denmark), rabbit anti-OCT4 (1:400), rabbit anti-NANOG (1:400; Cell Signaling Technology, Danvers, Mass., USA), mouse anti-SOX2 (1:50; Santa Cruz Biotechnology, Dallas, Tex., USA), mouse anti-TRA-1-60 (1:100), mouse anti-TRA-1-81 (1:100), mouse anti-Nestin (1:200), rabbit anti-Desmin (1:50; Millipore, Burlington, Mass., USA), mouse anti-SMA (1:500; Sigma-Aldrich), goat anti-SOX17 (1:50; R & D Systems) and rabbit anti-TUBB3 (1:1000; BioLegend, San Diego, Calif., USA). The cells were washed 6 times in PBST for 10 minutes each, and the cells were incubated at room temperature for 1 hour with appropriate secondary antibodies diluted in PBST as follows: Alexa Fluor 488, 594 goat anti-mouse IgG, Alexa Fluor 594 goat anti-rabbit IgG or Alexa Fluor 488 chicken anti-goat IgG (1:200; Thermo Fisher Scientific). The cells were then washed with PBST and stained with 4′-6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich) for visualization of nuclei. Endoplasmic reticulum (ER) was marked using ER Tracker™Green (Invitrogen) according to the manufacturer's protocol.

7. Ethoxyresorufin-O-Deetylase (EROD) Analysis

To measure the CYP1A1 activity, cells were cultured in a serum-free medium for 24 hours before treatment. The cells were treated with 7.5 μM ethoxyresorufin in the presence or absence of 10 μM dicumarol (inhibitor) in HBSS for 7.5, 15, 30 and 60 minutes, and 100 μl of the medium was removed into a new microcentrifuge tube. The same amount (100 μl) of ice-cold acetonitrile-methanol was added to the removed medium, followed by brief vortexing and centrifugation at 16,000×g for 5 minutes at 4° C. The supernatant was used for the following analysis. The level of the metabolite resorufin was measured by high-performance liquid chromatography (HPLC) with a Luna C18 column (4.6×150 mm, 5 μm; Phenomenex, Seoul, Korea). The moving phase was composed of 20 mM phosphate buffer-methanol-acetonitrile (52:45:3, v/v/v), and the flow rate was 0.8 ml/minute. Fluorescence was measured at an excitation wavelength of 560 nm and an emission wavelength of 585 nm. Concentrations were calculated using a standard curve for resorufin normalized by the total cellular protein content measured using a BCA protein analysis kit (Thermo Fisher Scientific).

8. Quantitative Reverse Transcription PCR (RT-qPCR)

Total RNA was extracted from each sample using NucleoZOL reagent (Macherey-Nagel, Duren, Germany) and reverse transcription was performed using GoScript™ reverse transcription mix (Promega) according to the manufacturer's protocol. RT-qPCR was performed with SYBR Green Realtime PCR Master Mix (TOYOBO, Osaka, Japan) in StepOnePlus Real-Time PCR system (Applied Biosystems, Foster City, Calif., USA). PCR amplification was performed in triplicate for each sample. PCR results were expressed as relative fold change compared to the control cells after normalization with glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The ΔCt (SΔCt) value was calculated as the difference between the Ct value obtained for GAPDH and the target gene. The ΔCt value of the control cells was used as the control ΔCt (CΔCt) value. The relative gene expression level was determined using the following formula: 2−(SΔCt−CΔCt). The primers used in the experiment are shown in Table 2.

9. Chemical Treatment and High-Content Screening (HCS)

To perform HCS, the cells differentiated for 10 days were dissociated, plated in a Matrigel®-coated 96-well plate, and cultured for maturation. After 24 hours of completion of differentiation, the cells were treated with 241 chemicals including hepatotoxicity library (SCREEN-WELL® Hepatotoxicity library; Enzo Life Sciences, Farmingdale, N.Y., USA) and nuclear receptor ligands library (SCREEN-WELL® Nuclear Receptor Ligands Library; Enzo Life Sciences), and AHR agonists (2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) and benzo[a]pyrene (BaP)) as positive controls for 24 and 48 hours. DMSO was used as a vehicle control. For staining the live cell nucleus, cells were cultured with 2 μg/ml of Hoechst 33342 (Life Technologies) for 10 minutes. Stained cells were imaged using ImageXpress Micro XLS Widefield High-Content Analysis System (Molecular Devices, San Jose, Calif., USA). The acquired images were analyzed using MetaXpress High-Content Image Acquisition and Analysis Software (Molecular Devices) according to disclosed methods. For analysis, cells were first identified using Hoechst staining and mCherry intensity was detected to measure CYP1A1 expression. All chemical concentrations used for screening were 10 μM except TCDD (10 nM), BaP (1 μM) and H01 (3-methylcholanthrene; 1 μM).

10. Dose-Response Curve

To measure a dose-response curve, the samples were incubated at individual concentrations for 24 hours with TCDD, BaP, papaverine hydrochloride, nordihydroguaret acid and glafenine. To measure dose-response curves, the samples were incubated with TCDD, BaP, papaverine hydrochloride, nordihydroguaretic acid and glafenine at individual concentrations (TCDD at concentrations of 0.1, 1, 10, and 50 μM and other compounds at concentrations of 0.01, 0.1, 1, 10, 50, and 100 μM) for 24 hours. After preparing cells for RNA extraction, RT-qPCR analysis for the expression of CYP1A1 mRNA was performed according to the above procedure. Dose-response curves were created by the least squares fitting method using GraphPad Prism 5 (GraphPad, San Diego, Calif., USA). The samples with low RNA concentration (<50 μg/ml) due to cell death were recovered.

11. Cell Viability Analysis

To analyze cell viability, target chemicals (10 μM) were treated for 24 hours prior to performing cell viability analysis. Then, 10 μl of cell counting Kit-8 was added to 100 μl of the medium, followed by incubation for 2 hours. Absorbance was measured at 450 nm using an iMark™ microplate absorbance reader (Bio-Rad). Cell viability was calculated using the following formula:

Cell viability (%)=(A_sample−A_blank)/(A_control−A_blank)×100

12. Microarray Analysis

For microarray analysis, total RNA samples of hiPSC-derived hepatocytes, and HepG2 and human primary hepatocytes (hPH) treated with or without 1 μM BaP were prepared using TRIzol reagent. Microarray analysis was performed using Agilent Human GE 4×44 V2 chip (Agilent, Santa Clara, USA) by a service provider (eBiogen, Seoul, Korea).

Gene ontology and KEGG pathway analysis was performed using DAVID with selection of gene ontology (Biological process, Molecular function, and Cellular components) and KEGG pathway. Principal component analysis (PCA), mean Z-score calculation, R-square and correlation plots were performed and visualized using R (v.3.6.1).

13. Statistical Analysis and Visualization

Graph visualization and statistical analysis of RT-qPCR, CYP1A1 activity and mCherry measurements were performed using GraphPad Prism 5 and Microsoft Excel (Redmond, Wash., USA). Chemical structures were drawn using MarvinSketch (v20.6; ChemAxon, Budapest, Hungary).

<Example 1> Preparation of mCherry Knock-In Vector Using CRISPR-Cas9 System

In order to establish a live monitoring system of AHR activity in hiPSCs, CYP1A1 transcriptionally regulated by AHR was targeted. To minimize the off-target effect of a fluorescent marker insertion, HR-mediated knock-in was induced in the target gene locus using the CRISPR-Cas9 system by the method described in <Experimental Methods>2. A targeting vector was designed to knock-in mCherry into the CYP1A1 gene locus in pre-established hiPSCs derived from normal fibroblasts (FIG. 1a). mCherry cDNA was inserted at the end of the last exon of CYP1A1 with a deletion of the stop codon. Phospho glycerate kinase (PGK)-neo and diphtheria toxin A (DT-A) were included in targeting vectors for positive and negative selection, respectively. Three single-guide RNAs (sgRNAs) were directed to target exon 4-exon 5 (E4-E5) or exon 6-exon 7 (E6-E7) introns (FIG. 1b). The efficiency of sgRNA was investigated by T7 endonuclease I analysis, and it was confirmed that all sgRNAs effectively induced DNA cleavage, resulting in indels more than 50% (FIG. 1c).

HiPSCs were transfected with a targeting vector containing Cas9 and individual sgRNA. For positive selection, the transfected hiPSCs were treated with G418, followed by single cell clone expansion. Modification of the target gene locus in the proliferating cells during the clone expansion was confirmed by PCR with the primer set shown in FIG. 1a (FIG. 1d). In order to confirm the integration of the cassette at the designated site, the results of sequencing the junction between CYP1A1 and mCherry and between PGKneo and CYP1A1 are shown in FIG. 1e (FIG. 1e).

As a result of the above experiment, six clones (#1-2, #1-7, #1-8, #1-9, #4-13 and #5-2) of the hiPSC line expressing mCherry-fused CYP1A1 were established and deposited at Korean Collection for Type Cultures (KCTC), Korea Research Institute of Bioscience and Biotechnology (KRIBB) under the accession number KCTC 14186BP.

<Experimental Example 1> Confirming Whether CYP1A1-mCherry hiPSCs Retain Characteristics of hiPSCs

Line #1-8 was selected as a line to be used in the experiment to determine whether CYP1A1-mCherry hiPSCs maintain the characteristics of hiPSCs. To investigate whether the CRISPR-Cas9-mediated gene editing affects the characteristics of hiPSCs, pluripotency and genomic stability characteristics were examined in CYP1A1-mCherry hiPSCs by the method described in <Experimental Methods>3.

As a result, as shown in FIG. 2a, the pluripotency markers such as NANOG, OCT4, SOX2, TRA 60 and TRA-1-81 were expressed in the line #1-8 (FIG. 2a). The possibility of cell differentiation into three germ layers was confirmed through EB formation assay. EB expressed all three germ layer markers at the mRNA (FIG. 2b) and protein (FIG. 2c) levels. In addition, as a result of confirming the karyotype of CYP1A1-mCherry hiPSCs, it was confirmed that the karyotype of the hiPSCs was normal (FIG. 2d).

From the above results, it was confirmed that the mCherry knock-in process induced by the CRISPR-Cas9 system did not affect the pluripotency of CYP1A1-mCherry hiPSCs.

<Experimental Example 2> Confirmation of Function of Hepatocytes Differentiated from CYP1A1-mCherry hiPSCs

CYP1A1 and its upstream regulator, the aryl hydrocarbon receptor (AHR), are involved in phase I xenobiotic and drug metabolism in the liver. Anticipating that the CYP1A1-mCherry hiPSC line could be used for compound and drug screening through hepatocyte differentiation, CYP1A1-mCherry hiPSCs were differentiated into hepatocytes by the stepwise direct differentiation protocol shown in FIG. 3 (FIG. 3). Then, the function of the differentiated hepatocytes was confirmed by the methods of <Experimental methods> 4, 5 and 6.

First, as a result of observing the cell morphology, as shown in FIG. 4a, the cell morphology was changed as follows at each stage of differentiation: definitive endoderm on day 5, liver progenitors on day 10, and hepatocytes on day 17 (FIG. 4a).

It was confirmed that the transcriptional expression of hepatocyte-specific marker genes such as ALB, AAT, TDO2, HNF4A, G6Pase, TAT, TTR and AFP was increased with the differentiation (FIG. 4b).

As a result of immunocytochemical analysis, as shown in FIG. 4c, the expression of hepatocyte-specific proteins such as ALB, AAT, AFP and HNF4A was confirmed in the differentiated hepatocytes (FIG. 4c).

In addition, the ratio of albumin-expressing cells was examined by the flow cytometry method of <Experimental methods>4, and it was confirmed that more than 96% of cells were albumin-positive HLCs on day 17 (FIG. 4d).

The function of the differentiated HLCs was confirmed by detection of albumin secretion into plasma (FIG. 4e) and low-density lipoprotein (LDL)-absorption analysis (FIG. 4f).

Dose-response curves of known CYP1A1 inducers (benzo [a] pyrene (BaP) and TCDD) indicate that the differentiated HLCs exhibit drug responses similar to those of other models by these chemicals (FIG. 4g).

From the above results, it was confirmed that the CYP1A1-mCherry hiPSC line successfully differentiated into HLCs by expressing essential liver markers and functions normally.