This application claims the benefit of U.S. Provisional Patent Application Serial Nos. 63/005,781, filed on Apr. 6, 2020, and 62/705,208, filed on Jun. 16, 2020, which are hereby incorporated by reference in their entirety.

FIELD

The present application relates to a diagnostic kit, compositions and methods for amplification and detection of SARS-CoV-2.

BACKGROUND

The severe acute respiratory coronavirus 2 (SARS-CoV-2), which emerged in December 2019 in Wuhan, China, has spread rapidly worldwide. The World Health Organization (WHO) called the disease caused by the virus, COVID-19. The outbreak was declared a Public Health Emergency of International Concern on Jan. 30, 2020, and a pandemic on Mar. 11, 2020 by WHO. As of May 18, 2020, the John Hopkins University Coronavirus Resource Center reported 4,730,323 confirmed cases worldwide and 315,482 deaths. This virus is reported to spread directly from person-to-person contact through respiratory droplets (such as coughing) or possibly through contaminated surfaces.

The first symptoms of the COVID-19 are not very specific. People may experience runny nose, headache, muscle pain and tiredness. Fever, cough and respiratory symptoms often occur two or three days later and can lead to severe pneumonia and death. The severity of clinical symptoms requires that approximately 20% of patients remain in hospital and 5% require admission to intensive care. The most serious forms are observed mainly in people who are vulnerable because of their age (over 70) or associated diseases. However, the infection can also be asymptomatic or paucisymptomatic (causing little or no clinical manifestations) in 30% to 60% of infected subjects. The duration of incubation is on average 5 days, with extremes of 2 to 12 days. More critically, it has been reported that a person showing no symptoms can transmit the virus to others, thus showing the importance of developing a sensitive and reliable test to detect SARS-CoV-2 to help save lives by limiting the spread of SARS-CoV-2.

SARS-CoV-2 belongs to the large family of Coronaviridae (genus Betacoronavirus). SARS-CoV-2 is genetically similar to SARS coronavirus and bat SARS-like coronaviruses. It is a positive-sense single-stranded RNA. Although bats are the likely reservoir hosts for SARS-CoV-2, there is still ongoing research investigating if pangolins (Manis javanica) are a possible intermediate host for this novel human virus (Lam et al., “Identifying SARS-CoV-2 Related Coronaviruses in Malayan Pangolins,” Nature doi.org/10.1038/s41586-020-2169-0 (2020)). SARS-CoV-2 is unique among known betacoronaviruses in its incorporation of a polybasic cleavage site, a characteristic known to increase pathogenicity and transmissibility in other viruses (Andersen et al., “The Proximal Origin of SARS-CoV-2,” Nature Medicine 26:450-452 (2020); Walls et al., “Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein,” Cell 181(2):281-292 (2020); Coutard et al., “The Spike Glycoprotein of the New Coronavirus 2019-nCoV Contains a Furin-like Cleavage Site Absent in CoV of the Same Clade,” Antiviral Research 176:104742 (2020)).

Currently, there are two broad categories of SARS-CoV-2 diagnostic tests. The first category includes molecular assays, such as polymerase chain reaction (PCR), for detecting the virus itself, and the second category includes immunoassays for detecting the host's response to the virus (Patel et al., “Report from the American Society for Microbiology COVID-19 International Summit, 23 Mar. 2020: Value of Diagnostic Testing for SARS-CoV-2/COVID-19,” mBio 11(2): e00722-20 (2020).

As the development of an antibody response to infection takes time, antibody testing is not useful for detecting infection in asymptomatic patients or in patients in the early stage of acute illness. Thus, not only are molecular assays to detect the presence of the virus in a sample more sensitive, but they are also a better option for early detection of infection which is necessary to effectively prevent the spread of COVID-19.

Currently, most of the available developed SARS-CoV-2 PCR tests are developed to detect multiple regions of the SARS-CoV-2 genome, with each target amplicon giving an output signal to a different detection channel (e.g., all amplicons of a first target region of SARS-CoV-2 produce a signal in a first channel and all amplicons of a second target region of SARS-CoV-2 produce a signal in a second channel). A limitation of single target detection per channel is the potential lack of robustness as genetic polymorphism or potential mutations could compromise virus detection, and thus potentially lead to false negative results (Nagy et al., “Evaluation of TaqMan qPCR System Integrating Two Identically Labelled Hydrolysis Probes in Single Assay,” Scientific Reports 7:41392 (2017)). The failure to detect virus in infected patients is a major concern in a pandemic situation as it prevents efficient containment of the virus and can provoke secondary infection sites or second “waves” of infection.

The present application is directed at overcoming these and other deficiencies in the art.

SUMMARY

A first aspect of the present application is directed to a method for detecting the presence or absence of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in a sample. This method involves contacting the sample with a primary oligonucleotide primer set, where the primary oligonucleotide primer set comprises (i) a first oligonucleotide primer comprising a nucleotide sequence complementary to a first portion of the SARS-CoV-2 transmembrane domain 2 gene of the open reading frame 1a (ORF1a), and (ii) a second oligonucleotide primer comprising a nucleotide sequence complementary to an extension product formed from the first oligonucleotide primer of the primary oligonucleotide primer set. The contacted sample is then subjected to an amplification reaction under conditions suitable for producing transmembrane domain 2 gene amplification products, and the presence or absence of SARS-CoV-2 in the sample is detected based on the production of those amplification products.

Another aspect of the present disclosure is directed to a method for detecting the presence or absence of SARS-CoV-2 in a sample that involves contacting the sample with the primary oligonucleotide primer set described above, and a secondary oligonucleotide primer set. The secondary oligonucleotide primer set comprises (i) a first oligonucleotide primer comprising a nucleotide sequence complementary to a first portion of the SARS-CoV-2 N gene, and (ii) a second oligonucleotide primer comprising a nucleotide sequence complementary to an extension product formed from the first oligonucleotide primer of the secondary oligonucleotide primer set. In accordance with this aspect, the amplification reaction is carried out under conditions suitable for producing transmembrane domain 2 and N gene amplification products, and the presence or absence of SARS-CoV-2 is detected based on the production of those amplification products.

Another aspect of the present application is directed to an isolated oligonucleotide suitable for detecting SARS-CoV-2. The isolated oligonucleotide comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.

Another aspect of the present application is directed to an oligonucleotide primer set for detecting SARS-CoV-2 transmembrane domain 2 gene. The oligonucleotide primer set comprises a first oligonucleotide primer comprising the nucleotide sequence of SEQ ID NO: 1, and a second oligonucleotide primer comprising the nucleotide sequence of SEQ ID NO: 2.

Another aspect of the present application is directed to an oligonucleotide primer set for detecting SARS-CoV-2 N gene. The oligonucleotide primer set comprises a first oligonucleotide primer comprising the nucleotide sequence of SEQ ID NO: 4, and a second oligonucleotide primer comprising the nucleotide sequence of SEQ ID NO: 5.

The present application discloses a real-time reverse transcription polymerase chain reaction (RT-PCR) that provides a solution to the clinical need for a sensitive assay specific for the detection of SARS-CoV-2 in a biological sample. This assay features oligonucleotides which are suitable for determining whether SARS-CoV-2 is qualitatively present in a test sample (e.g., a nasopharyngeal sample) obtained from an individual suspected of having COVID-19. A dual-target assay with identically labelled probes is provided to circumvent the potential issue of false negative results due to genetic polymorphisms or potential mutations. Thus, the disclosed assay better guarantees inclusivity of the assay in the future.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a schematic illustrating the relative positions of amplicon targets on SARS-CoV-2. The two SARS-CoV-2 genomic regions targeted by the two different SARS-CoV-2 primer and probe sets are located (i) in the opening reading frame lab (ORF1ab) region (region coding for the Transmembrane domain 2 (TM2) gene of ORF1a) located at position 9928-10007 within the complete SARS-CoV-2 genome sequence, and (ii) in the N gene (coding for the Nucleo-capsid phosphoprotein) located at position 29257-29339 within the complete SARS-CoV-2 genome sequence. The expected size of amplicons are as follows: 80 base pairs for the target in ORF1ab region and 83 base pairs for the target in N gene.

FIGS. 2A-2C are tables showing the results (Ct values) of a study comparing sensitivity of the SARS-CoV-2 detection assay described in the present application (“Test Method”) to the Seegene SARS-CoV-2 detection assay (FIG. 2A), the Roche SARS-CoV-2 detection assay (FIG. 2B), and the Vircell SARS-CoV-2 detection assay (FIG. 2C).

DETAILED DESCRIPTION

The present disclosure is directed to methods and reagents suitable for detecting severe acute respiratory coronavirus 2 (SARS-CoV-2), which emerged in December 2019 in Wuhan, China. SARS-CoV-2 comprises a single-stranded RNA genome that varies in size from 29.8 kb to 29.9 kb. The first sequence of the SARS-CoV-2 genome isolated from Wuhan was deposited in Genbank as accession no. NC_045512. The genomic structure of SARS-CoV-2 is characteristic of other known coronaviruses. In particular, more than two-thirds of the genome comprises the ORF1ab region (comprising ORF1a and ORF1b), which is located at the 5′ end of the genome and encodes ORF1ab polyproteins. The remaining one third of the genome, located 3′ to the ORF1ab region, consists of genes encoding structural proteins including surface (S), envelope (E), membrane (M), and nucleocapsid (N) proteins. Additionally, the SARS-CoV-2 contains six accessory proteins, encoded by ORF3a, ORF6, ORF7a, ORF7b, and ORF8 regions. The methods of detecting SARS-CoV-2 as disclosed herein are achieved by detecting at least a first unique region of the SARS-CoV-2 genomic RNA within ORF1a known as the transmembrane domain 2 gene. This gene region is detected alone or together with a second unique region SARS-CoV-2 genomic RNA located within the N gene.

Accordingly, a first aspect of the present application is directed to a method for detecting the presence or absence of SARS-CoV-2 in a sample. This method involves contacting the sample with a primary oligonucleotide primer set. The primary oligonucleotide primer set comprises: (i) a first oligonucleotide primer comprising a nucleotide sequence complementary to a first portion of the SARS-CoV-2 transmembrane domain 2 (TM2) gene of ORF1a, and (ii) a second oligonucleotide primer comprising a nucleotide sequence complementary to an extension product formed from the first oligonucleotide primer. The contacted sample is subjected to an amplification reaction under conditions suitable for producing TM2 gene amplification products, and the presence or absence of SARS-CoV-2 in the sample is detected based on the production of those TM2 gene amplification products.

As described above, the first characterized SARS-CoV-2 genomic RNA sequence is that which was deposited with Genbank and accorded the accession number NC_045512. While the primers and probes described herein were designed in reference to this genomic sequence, it is understood that the methods of detecting SARS-CoV-2 as described herein are not limited to the detection of only this isolate of the virus, but also encompass the detection of other isolates and natural variants of the SARS-CoV-2 virus. To date there are over 3500 genomic sequences of SARS-CoV-2 isolates found in GenBank, and the methods disclosed herein are suitable for detecting the presence of each of these genomic sequences in a sample.

A natural variant of SARS-CoV-2 has a sequence that is different from the genomic sequence of SARS-CoV-2 (Wuhan isolate) due to one or more naturally occurred mutations, including, but not limited to, point mutations, rearrangements, insertions, deletions, etc., to the genomic sequence that may or may not result in a phenotypic change. In some embodiments, variants of SARS-CoV-2 detected using the methods disclosed comprise at least 75% sequence similarity to the genome of the Wuhan isolate, at least 80% sequence similarity to the genome of the Wuhan isolate, at least 85% sequence similarity to the genome of the Wuhan isolate, at least 90% sequence similarity to the genome of the Wuhan isolate, at least 95% sequence similarity to the genome of the Wuhan isolate, or >95% sequence similarity to the genome of the Wuhan isolate.

As used herein, “sample” refers to any biological sample potentially containing the genomic RNA of the SARS-CoV-2. In some embodiments, the biological sample is a biological fluid or biological tissue. Biological fluid samples that can be subjected to the methods disclosed herein include, without limitation, a nasopharyngeal sample, an oropharyngeal sample, a saliva sample. Other suitable biological fluid samples include, urine, blood, plasma, serum, semen, stool, sputum, cerebrospinal fluid, tears, mucus, amniotic fluid, and the like. A biological tissue sample is a sample comprising a specific type or types of cell aggregate(s) (combined with those intercellular substances that form one of the structural materials of human, animal, plant, bacterial, fungal or viral structure). Examples of biological tissue samples that can be subjected to the methods disclosed herein include, without limitation, tissue biopsies or individual cell(s). In the case of a biological sample, the sample may be a crude sample or a processed sample obtained after various processing or preparation of the original sample.

As described above, the SARS-CoV-2 genome is a single-stranded RNA genome. Therefore, in some embodiments it is beneficial or otherwise necessary to extract or isolated RNA from the sample prior to or for analysis. RNA molecules can be isolated from cells and tissue and quantified using methods known in the art, e.g., guanidinium-acid-phenol extraction, density gradient centrifugation using cesium chloride or cesium trifluoroacetate, glass fiber filtration, and magnetic bead separation, with the particular extraction procedure chosen based on the sample. In some instances, with some techniques, it may also be possible to analyze the nucleic acid without extracting RNA from the sample.

In practicing the methods of the present application, the SARS-CoV-2 RNA or portions thereof are reverse-transcribed to synthesize complementary DNA (cDNA), which is then amplified and detected or directly detected. Reverse transcription of the SARS-CoV-2 RNA or portions thereof can be achieved using a reverse transcriptase enzyme (e.g., avian myeloblastosis virus reverse transcriptase or moloney murine leukemia virus reverse transcriptase), a mixture of deoxyribonucleotides, and the appropriate buffers and reaction conditions which are well known to those of skill in the art. In some embodiments, the reverse transcription reaction is primed using random hexamer primers or oligo(dT) primers. In some embodiments, the reverse transcription reaction is primed using gene specific primers. For example, in some embodiments, the reverse transcription reaction is primed using the first primer of the primary oligonucleotide primer set as described herein, i.e., a primer comprising a sequence that is complementary to a region of the TM2 gene within ORF1a. In some embodiments, the reverse transcription reaction is primed using the first primer of the secondary oligonucleotide primer set as described herein, i.e., a primer comprising a nucleotide sequence that is complementary to a region of the N gene. In some embodiments, the reverse transcription reaction is primed using the first primer of the primary oligonucleotide primer set and the first primer of the secondary oligonucleotide primer set as described herein. Thus, in some embodiments, the sample is a sample comprising the reverse transcription product of the SARS-CoV-2 genomic RNA.

Reverse transcription can be performed alone or in combination with an amplification step, e.g., reverse transcription polymerase chain reaction, which may be further modified to be quantitative, e.g., quantitative real time RT-PCR as described in U.S. Pat. No. 5,639,606 and Holland et al., Proc Natl Acad Sci USA 88(16):7276 (1991), which are hereby incorporated by reference in their entirety. Suitable amplification reaction processes are described in more detail infra.

The nucleic acid sequence of the ORF1ab region of SARS-CoV-2 is provided below as SEQ ID NO: 10 (Genbank Accession No. QHD43415.1; UniProt ID No. P0DTC1; Wu et al., “A New Coronavirus Associated with Human Respiratory Disease in China” Nature 579(7798):265-269(2020), which is hereby incorporated by reference in its entirety).

auggagagcc uugucccugg uuucaacgag aaaacacacg uccaacucag uuugccuguu 60

uuacagguuc gcgacgugcu cguacguggc uuuggagacu ccguggagga ggucuuauca 120

gaggcacguc aacaucuuaa agauggcacu uguggcuuag uagaaguuga aaaaggcguu 180

uugccucaac uugaacagcc cuauguguuc aucaaacguu cggaugcucg aacugcaccu 240

cauggucaug uuaugguuga gcugguagca gaacucgaag gcauucagua cggucguagu 300

ggugagacac uugguguccu ugucccucau gugggcgaaa uaccaguggc uuaccgcaag 360

guucuucuuc guaagaacgg uaauaaagga gcugguggcc auaguuacgg cgccgaucua 420

aagucauuug acuuaggcga cgagcuuggc acugauccuu augaagauuu ucaagaaaac 480

uggaacacua aacauagcag ugguguuacc cgugaacuca ugcgugagcu uaacggaggg 540

gcauacacuc gcuaugucga uaacaacuuc uguggcccug auggcuaccc ucuugagugc 600

auuaaagacc uucuagcacg ugcugguaaa gcuucaugca cuuuguccga acaacuggac 660

uuuauugaca cuaagagggg uguauacugc ugccgugaac augagcauga aauugcuugg 720

uacacggaac guucugaaaa gagcuaugaa uugcagacac cuuuugaaau uaaauuggca 780

aagaaauuug acaccuucaa uggggaaugu ccaaauuuug uauuucccuu aaauuccaua 840

aucaagacua uucaaccaag gguugaaaag aaaaagcuug auggcuuuau ggguagaauu 900

cgaucugucu auccaguugc gucaccaaau gaaugcaacc aaaugugccu uucaacucuc 960

augaagugug aucauugugg ugaaacuuca uggcagacgg gcgauuuugu uaaagccacu 1020

ugcgaauuuu guggcacuga gaauuugacu aaagaaggug ccacuacuug ugguuacuua 1080

ccccaaaaug cuguuguuaa aauuuauugu ccagcauguc acaauucaga aguaggaccu 1140

gagcauaguc uugccgaaua ccauaaugaa ucuggcuuga aaaccauucu ucguaagggu 1200

ggucgcacua uugccuuugg aggcugugug uucucuuaug uugguugcca uaacaagugu 1260

gccuauuggg uuccacgugc uagcgcuaac auagguugua accauacagg uguuguugga 1320

gaagguuccg aaggucuuaa ugacaaccuu cuugaaauac uccaaaaaga gaaagucaac 1380

aucaauauug uuggugacuu uaaacuuaau gaagagaucg ccauuauuuu ggcaucuuuu 1440

ucugcuucca caagugcuuu uguggaaacu gugaaagguu uggauuauaa agcauucaaa 1500

caaauuguug aauccugugg uaauuuuaaa guuacaaaag gaaaagcuaa aaaaggugcc 1560

uggaauauug gugaacagaa aucaauacug aguccucuuu augcauuugc aucagaggcu 1620

gcucguguug uacgaucaau uuucucccgc acucuugaaa cugcucaaaa uucugugcgu 1680

guuuuacaga aggccgcuau aacaauacua gauggaauuu cacaguauuc acugagacuc 1740

auugaugcua ugauguucac aucugauuug gcuacuaaca aucuaguugu aauggccuac 1800

auuacaggug guguuguuca guugacuucg caguggcuaa cuaacaucuu uggcacuguu 1860

uaugaaaaac ucaaacccgu ccuugauugg cuugaagaga aguuuaagga agguguagag 1920

uuucuuagag acgguuggga aauuguuaaa uuuaucucaa ccugugcuug ugaaauuguc 1980

gguggacaaa uugucaccug ugcaaaggaa auuaaggaga guguucagac auucuuuaag 2040

cuuguaaaua aauuuuuggc uuugugugcu gacucuauca uuauuggugg agcuaaacuu 2100

aaagccuuga auuuagguga aacauuuguc acgcacucaa agggauugua cagaaagugu 2160

guuaaaucca gagaagaaac uggccuacuc augccucuaa aagccccaaa agaaauuauc 2220

uucuuagagg gagaaacacu ucccacagaa guguuaacag aggaaguugu cuugaaaacu 2280

ggugauuuac aaccauuaga acaaccuacu agugaagcug uugaagcucc auugguuggu 2340

acaccaguuu guauuaacgg gcuuauguug cucgaaauca aagacacaga aaaguacugu 2400

gcccuugcac cuaauaugau gguaacaaac aauaccuuca cacucaaagg cggugcacca 2460

acaaagguua cuuuugguga ugacacugug auagaagugc aagguuacaa gagugugaau 2520

aucacuuuug aacuugauga aaggauugau aaaguacuua augagaagug cucugccuau 2580

acaguugaac ucgguacaga aguaaaugag uucgccugug uuguggcaga ugcugucaua 2640

aaaacuuugc aaccaguauc ugaauuacuu acaccacugg gcauugauuu agaugagugg 2700

aguauggcua cauacuacuu auuugaugag ucuggugagu uuaaauuggc uucacauaug 2760

uauuguucuu ucuacccucc agaugaggau gaagaagaag gugauuguga agaagaagag 2820

uuugagccau caacucaaua ugaguauggu acugaagaug auuaccaagg uaaaccuuug 2880

gaauuuggug ccacuucugc ugcucuucaa ccugaagaag agcaagaaga agauugguua 2940

gaugaugaua gucaacaaac uguuggucaa caagacggca gugaggacaa ucagacaacu 3000

acuauucaaa caauuguuga gguucaaccu caauuagaga uggaacuuac accaguuguu 3060

cagacuauug aagugaauag uuuuaguggu uauuuaaaac uuacugacaa uguauacauu 3120

aaaaaugcag acauugugga agaagcuaaa aagguaaaac caacaguggu uguuaaugca 3180

gccaauguuu accuuaaaca uggaggaggu guugcaggag ccuuaaauaa ggcuacuaac 3240

aaugccaugc aaguugaauc ugaugauuac auagcuacua auggaccacu uaaagugggu 3300

gguaguugug uuuuaagcgg acacaaucuu gcuaaacacu gucuucaugu ugucggccca 3360

aauguuaaca aaggugaaga cauucaacuu cuuaagagug cuuaugaaaa uuuuaaucag 3420

cacgaaguuc uacuugcacc auuauuauca gcugguauuu uuggugcuga cccuauacau 3480

ucuuuaagag uuuguguaga uacuguucgc acaaaugucu acuuagcugu cuuugauaaa 3540

aaucucuaug acaaacuugu uucaagcuuu uuggaaauga agagugaaaa gcaaguugaa 3600

caaaagaucg cugagauucc uaaagaggaa guuaagccau uuauaacuga aaguaaaccu 3660

ucaguugaac agagaaaaca agaugauaag aaaaucaaag cuuguguuga agaaguuaca 3720

acaacucugg aagaaacuaa guuccucaca gaaaacuugu uacuuuauau ugacauuaau 3780

ggcaaucuuc auccagauuc ugccacucuu guuagugaca uugacaucac uuucuuaaag 3840

aaagaugcuc cauauauagu gggugauguu guucaagagg guguuuuaac ugcugugguu 3900

auaccuacua aaaaggcugg uggcacuacu gaaaugcuag cgaaagcuuu gagaaaagug 3960

ccaacagaca auuauauaac cacuuacccg ggucaggguu uaaaugguua cacuguagag 4020

gaggcaaaga cagugcuuaa aaaguguaaa agugccuuuu acauucuacc aucuauuauc 4080

ucuaaugaga agcaagaaau ucuuggaacu guuucuugga auuugcgaga aaugcuugca 4140

caugcagaag aaacacgcaa auuaaugccu gucugugugg aaacuaaagc cauaguuuca 4200

acuauacagc guaaauauaa ggguauuaaa auacaagagg gugugguuga uuauggugcu 4260

agauuuuacu uuuacaccag uaaaacaacu guagcgucac uuaucaacac acuuaacgau 4320

cuaaaugaaa cucuuguuac aaugccacuu ggcuauguaa cacauggcuu aaauuuggaa 4380

gaagcugcuc gguauaugag aucucucaaa gugccagcua caguuucugu uucuucaccu 4440

gaugcuguua cagcguauaa ugguuaucuu acuucuucuu cuaaaacacc ugaagaacau 4500

uuuauugaaa ccaucucacu ugcugguucc uauaaagauu gguccuauuc uggacaaucu 4560

acacaacuag guauagaauu ucuuaagaga ggugauaaaa guguauauua cacuaguaau 4620

ccuaccacau uccaccuaga uggugaaguu aucaccuuug acaaucuuaa gacacuucuu 4680

ucuuugagag aagugaggac uauuaaggug uuuacaacag uagacaacau uaaccuccac 4740

acgcaaguug uggacauguc aaugacauau ggacaacagu uugguccaac uuauuuggau 4800

ggagcugaug uuacuaaaau aaaaccucau aauucacaug aagguaaaac auuuuauguu 4860

uuaccuaaug augacacucu acguguugag gcuuuugagu acuaccacac aacugauccu 4920

aguuuucugg guagguacau gucagcauua aaucacacua aaaaguggaa auacccacaa 4980

guuaaugguu uaacuucuau uaaaugggca gauaacaacu guuaucuugc cacugcauug 5040

uuaacacucc aacaaauaga guugaaguuu aauccaccug cucuacaaga ugcuuauuac 5100

agagcaaggg cuggugaagc ugcuaacuuu ugugcacuua ucuuagccua cuguaauaag 5160

acaguaggug aguuagguga uguuagagaa acaaugaguu acuuguuuca acaugccaau 5220

uuagauucuu gcaaaagagu cuugaacgug guguguaaaa cuuguggaca acagcagaca 5280

acccuuaagg guguagaagc uguuauguac augggcacac uuucuuauga acaauuuaag 5340

aaagguguuc agauaccuug uacguguggu aaacaagcua caaaauaucu aguacaacag 5400

gagucaccuu uuguuaugau gucagcacca ccugcucagu augaacuuaa gcaugguaca 5460

uuuacuugug cuagugagua cacugguaau uaccagugug gucacuauaa acauauaacu 5520

ucuaaagaaa cuuuguauug cauagacggu gcuuuacuua caaaguccuc agaauacaaa 5580

gguccuauua cggauguuuu cuacaaagaa aacaguuaca caacaaccau aaaaccaguu 5640

acuuauaaau uggauggugu uguuuguaca gaaauugacc cuaaguugga caauuauuau 5700

aagaaagaca auucuuauuu cacagagcaa ccaauugauc uuguaccaaa ccaaccauau 5760

ccaaacgcaa gcuucgauaa uuuuaaguuu guaugugaua auaucaaauu ugcugaugau 5820

uuaaaccagu uaacugguua uaagaaaccu gcuucaagag agcuuaaagu uacauuuuuc 5880

ccugacuuaa auggugaugu gguggcuauu gauuauaaac acuacacacc cucuuuuaag 5940

aaaggagcua aauuguuaca uaaaccuauu guuuggcaug uuaacaaugc aacuaauaaa 6000

gccacguaua aaccaaauac cugguguaua cguugucuuu ggagcacaaa accaguugaa 6060

acaucaaauu cguuugaugu acugaaguca gaggacgcgc agggaaugga uaaucuugcc 6120

ugcgaagauc uaaaaccagu cucugaagaa guaguggaaa auccuaccau acagaaagac 6180

guucuugagu guaaugugaa aacuaccgaa guuguaggag acauuauacu uaaaccagca 6240

aauaauaguu uaaaaauuac agaagagguu ggccacacag aucuaauggc ugcuuaugua 6300

gacaauucua gucuuacuau uaagaaaccu aaugaauuau cuagaguauu agguuugaaa 6360

acccuugcua cucaugguuu agcugcuguu aauagugucc cuugggauac uauagcuaau 6420

uaugcuaagc cuuuucuuaa caaaguuguu aguacaacua cuaacauagu uacacggugu 6480

uuaaaccgug uuuguacuaa uuauaugccu uauuucuuua cuuuauugcu acaauugugu 6540

acuuuuacua gaaguacaaa uucuagaauu aaagcaucua ugccgacuac uauagcaaag 6600

aauacuguua agagugucgg uaaauuuugu cuagaggcuu cauuuaauua uuugaaguca 6660

ccuaauuuuu cuaaacugau aaauauuaua auuugguuuu uacuauuaag uguuugccua 6720

gguucuuuaa ucuacucaac cgcugcuuua gguguuuuaa ugucuaauuu aggcaugccu 6780

ucuuacugua cugguuacag agaaggcuau uugaacucua cuaaugucac uauugcaacc 6840

uacuguacug guucuauacc uuguaguguu ugucuuagug guuuagauuc uuuagacacc 6900

uauccuucuu uagaaacuau acaaauuacc auuucaucuu uuaaauggga uuuaacugcu 6960

uuuggcuuag uugcagagug guuuuuggca uauauucuuu ucacuagguu uuucuaugua 7020

cuuggauugg cugcaaucau gcaauuguuu uucagcuauu uugcaguaca uuuuauuagu 7080

aauucuuggc uuaugugguu aauaauuaau cuuguacaaa uggccccgau uucagcuaug 7140

guuagaaugu acaucuucuu ugcaucauuu uauuauguau ggaaaaguua ugugcauguu 7200

guagacgguu guaauucauc aacuuguaug auguguuaca aacguaauag agcaacaaga 7260

gucgaaugua caacuauugu uaaugguguu agaagguccu uuuaugucua ugcuaaugga 7320

gguaaaggcu uuugcaaacu acacaauugg aauuguguua auugugauac auucugugcu 7380

gguaguacau uuauuaguga ugaaguugcg agagacuugu cacuacaguu uaaaagacca 7440

auaaauccua cugaccaguc uucuuacauc guugauagug uuacagugaa gaaugguucc 7500

auccaucuuu acuuugauaa agcuggucaa aagacuuaug aaagacauuc ucucucucau 7560

uuuguuaacu uagacaaccu gagagcuaau aacacuaaag guucauugcc uauuaauguu 7620

auaguuuuug augguaaauc aaaaugugaa gaaucaucug caaaaucagc gucuguuuac 7680

uacagucagc uuauguguca accuauacug uuacuagauc aggcauuagu gucugauguu 7740

ggugauagug cggaaguugc aguuaaaaug uuugaugcuu acguuaauac guuuucauca 7800

acuuuuaacg uaccaaugga aaaacucaaa acacuaguug caacugcaga agcugaacuu 7860

gcaaagaaug uguccuuaga caaugucuua ucuacuuuua uuucagcagc ucggcaaggg 7920

uuuguugauu cagauguaga aacuaaagau guuguugaau gucuuaaauu gucacaucaa 7980

ucugacauag aaguuacugg cgauaguugu aauaacuaua ugcucaccua uaacaaaguu 8040

gaaaacauga caccccguga ccuuggugcu uguauugacu guagugcgcg ucauauuaau 8100

gcgcagguag caaaaaguca caacauugcu uugauaugga acguuaaaga uuucauguca 8160

uugucugaac aacuacgaaa acaaauacgu agugcugcua aaaagaauaa cuuaccuuuu 8220

aaguugacau gugcaacuac uagacaaguu guuaauguug uaacaacaaa gauagcacuu 8280

aaggguggua aaauuguuaa uaauugguug aagcaguuaa uuaaaguuac acuuguguuc 8340

cuuuuuguug cugcuauuuu cuauuuaaua acaccuguuc augucauguc uaaacauacu 8400

gacuuuucaa gugaaaucau aggauacaag gcuauugaug guggugucac ucgugacaua 8460

gcaucuacag auacuuguuu ugcuaacaaa caugcugauu uugacacaug guuuagccag 8520

cgugguggua guuauacuaa ugacaaagcu ugcccauuga uugcugcagu cauaacaaga 8580

gaaguggguu uugucgugcc ugguuugccu ggcacgauau uacgcacaac uaauggugac 8640

uuuuugcauu ucuuaccuag aguuuuuagu gcaguuggua acaucuguua cacaccauca 8700

aaacuuauag aguacacuga cuuugcaaca ucagcuugug uuuuggcugc ugaauguaca 8760

auuuuuaaag augcuucugg uaagccagua ccauauuguu augauaccaa uguacuagaa 8820

gguucuguug cuuaugaaag uuuacgcccu gacacacguu augugcucau ggauggcucu 8880

auuauucaau uuccuaacac cuaccuugaa gguucuguua gagugguaac aacuuuugau 8940

ucugaguacu guaggcacgg cacuugugaa agaucagaag cugguguuug uguaucuacu 9000

agugguagau ggguacuuaa caaugauuau uacagaucuu uaccaggagu uuucuguggu 9060

guagaugcug uaaauuuacu uacuaauaug uuuacaccac uaauucaacc uauuggugcu 9120

uuggacauau cagcaucuau aguagcuggu gguauuguag cuaucguagu aacaugccuu 9180

gccuacuauu uuaugagguu uagaagagcu uuuggugaau acagucaugu aguugccuuu 9240

aauacuuuac uauuccuuau gucauucacu guacucuguu uaacaccagu uuacucauuc 9300

uuaccuggug uuuauucugu uauuuacuug uacuugacau uuuaucuuac uaaugauguu 9360

ucuuuuuuag cacauauuca guggaugguu auguucacac cuuuaguacc uuucuggaua 9420

acaauugcuu auaucauuug uauuuccaca aagcauuucu auugguucuu uaguaauuac 9480

cuaaagagac guguagucuu uaaugguguu uccuuuagua cuuuugaaga agcugcgcug 9540

ugcaccuuuu uguuaaauaa agaaauguau cuaaaguugc guagugaugu gcuauuaccu 9600

cuuacgcaau auaauagaua cuuagcucuu uauaauaagu acaaguauuu uaguggagca 9660

auggauacaa cuagcuacag agaagcugcu uguugucauc ucgcaaaggc ucucaaugac 9720

uucaguaacu cagguucuga uguucuuuac caaccaccac aaaccucuau caccucagcu 9780

guuuugcaga gugguuuuag aaaaauggca uucccaucug guaaaguuga ggguuguaug 9840

guacaaguaa cuugugguac aacuacacuu aacggucuuu ggcuugauga cguaguuuac 9900

uguccaagac augugaucug caccucugaa gacaugcuua acccuaauua ugaagauuua 9960

cucauucgua agucuaauca uaauuucuug guacaggcug guaauguuca acucaggguu 10020

auuggacauu cuaugcaaaa uuguguacuu aagcuuaagg uugauacagc caauccuaag 10080

acaccuaagu auaaguuugu ucgcauucaa ccaggacaga cuuuuucagu guuagcuugu 10140

uacaaugguu caccaucugg uguuuaccaa ugugcuauga ggcccaauuu cacuauuaag 10200

gguucauucc uuaaugguuc augugguagu guugguuuua acauagauua ugacuguguc 10260

ucuuuuuguu acaugcacca uauggaauua ccaacuggag uucaugcugg cacagacuua 10320

gaagguaacu uuuauggacc uuuuguugac aggcaaacag cacaagcagc ugguacggac 10380

acaacuauua caguuaaugu uuuagcuugg uuguacgcug cuguuauaaa uggagacagg 10440

ugguuucuca aucgauuuac cacaacucuu aaugacuuua accuuguggc uaugaaguac 10500

aauuaugaac cucuaacaca agaccauguu gacauacuag gaccucuuuc ugcucaaacu 10560

ggaauugccg uuuuagauau gugugcuuca uuaaaagaau uacugcaaaa ugguaugaau 10620

ggacguacca uauuggguag ugcuuuauua gaagaugaau uuacaccuuu ugauguuguu 10680

agacaaugcu cagguguuac uuuccaaagu gcagugaaaa gaacaaucaa ggguacacac 10740

cacugguugu uacucacaau uuugacuuca cuuuuaguuu uaguccagag uacucaaugg 10800

ucuuuguucu uuuuuuugua ugaaaaugcc uuuuuaccuu uugcuauggg uauuauugcu 10860

augucugcuu uugcaaugau guuugucaaa cauaagcaug cauuucucug uuuguuuuug 10920

uuaccuucuc uugccacugu agcuuauuuu aauauggucu auaugccugc uaguugggug 10980

augcguauua ugacaugguu ggauaugguu gauacuaguu ugucugguuu uaagcuaaaa 11040

gacuguguua uguaugcauc agcuguagug uuacuaaucc uuaugacagc aagaacugug 11100

uaugaugaug gugcuaggag aguguggaca cuuaugaaug ucuugacacu cguuuauaaa 11160

guuuauuaug guaaugcuuu agaucaagcc auuuccaugu gggcucuuau aaucucuguu 11220

acuucuaacu acucaggugu aguuacaacu gucauguuuu uggccagagg uauuguuuuu 11280

auguguguug aguauugccc uauuuucuuc auaacuggua auacacuuca guguauaaug 11340

cuaguuuauu guuucuuagg cuauuuuugu acuuguuacu uuggccucuu uuguuuacuc 11400

aaccgcuacu uuagacugac ucuugguguu uaugauuacu uaguuucuac acaggaguuu 11460

agauauauga auucacaggg acuacuccca cccaagaaua gcauagaugc cuucaaacuc 11520

aacauuaaau uguugggugu ugguggcaaa ccuuguauca aaguagccac uguacagucu 11580

aaaaugucag auguaaagug cacaucagua gucuuacucu caguuuugca acaacucaga 11640

guagaaucau caucuaaauu gugggcucaa uguguccagu uacacaauga cauucucuua 11700

gcuaaagaua cuacugaagc cuuugaaaaa augguuucac uacuuucugu uuugcuuucc 11760

augcagggug cuguagacau aaacaagcuu ugugaagaaa ugcuggacaa cagggcaacc 11820

uuacaagcua uagccucaga guuuaguucc cuuccaucau augcagcuuu ugcuacugcu 11880

caagaagcuu augagcaggc uguugcuaau ggugauucug aaguuguucu uaaaaaguug 11940

aagaagucuu ugaauguggc uaaaucugaa uuugaccgug augcagccau gcaacguaag 12000

uuggaaaaga uggcugauca agcuaugacc caaauguaua aacaggcuag aucugaggac 12060

aagagggcaa aaguuacuag ugcuaugcag acaaugcuuu ucacuaugcu uagaaaguug 12120

gauaaugaug cacucaacaa cauuaucaac aaugcaagag augguugugu ucccuugaac 12180

auaauaccuc uuacaacagc agccaaacua augguuguca uaccagacua uaacacauau 12240

aaaaauacgu gugaugguac aacauuuacu uaugcaucag cauuguggga aauccaacag 12300

guuguagaug cagauaguaa aauuguucaa cuuagugaaa uuaguaugga caauucaccu 12360

aauuuagcau ggccucuuau uguaacagcu uuaagggcca auucugcugu caaauuacag 12420

aauaaugagc uuaguccugu ugcacuacga cagaugucuu gugcugccgg uacuacacaa 12480

acugcuugca cugaugacaa ugcguuagcu uacuacaaca caacaaaggg agguagguuu 12540

guacuugcac uguuauccga uuuacaggau uugaaauggg cuagauuccc uaagagugau 12600

ggaacuggua cuaucuauac agaacuggaa ccaccuugua gguuuguuac agacacaccu 12660

aaagguccua aagugaagua uuuauacuuu auuaaaggau uaaacaaccu aaauagaggu 12720

augguacuug guaguuuagc ugccacagua cgucuacaag cugguaaugc aacagaagug 12780

ccugccaauu caacuguauu aucuuucugu gcuuuugcug uagaugcugc uaaagcuuac 12840

aaagauuauc uagcuagugg gggacaacca aucacuaauu guguuaagau guuguguaca 12900

cacacuggua cuggucaggc aauaacaguu acaccggaag ccaauaugga ucaagaaucc 12960

uuugguggug caucguguug ucuguacugc cguugccaca uagaucaucc aaauccuaaa 13020

ggauuuugug acuuaaaagg uaaguaugua caaauaccua caacuugugc uaaugacccu 13080

guggguuuua cacuuaaaaa cacagucugu accgucugcg guauguggaa agguuauggc 13140

uguaguugug aucaacuccg cgaacccaug cuucagucag cugaugcaca aucguuuuua 13200

aaccggguuu gcgguguaag ugcagcccgu cuuacaccgu gcggcacagg cacuaguacu 13260

gaugucguau acagggcuuu ugacaucuac aaugauaaag uagcugguuu ugcuaaauuc 13320

cuaaaaacua auuguugucg cuuccaagaa aaggacgaag augacaauuu aauugauucu 13380

uacuuuguag uuaagagaca cacuuucucu aacuaccaac augaagaaac aauuuauaau 13440

uuacuuaagg auuguccagc uguugcuaaa caugacuucu uuaaguuuag aauagacggu 13500

gacaugguac cacauauauc acgucaacgu cuuacuaaau acacaauggc agaccucguc 13560

uaugcuuuaa ggcauuuuga ugaagguaau ugugacacau uaaaagaaau acuugucaca 13620

uacaauuguu gugaugauga uuauuucaau aaaaaggacu gguaugauuu uguagaaaac 13680

ccagauauau uacgcguaua cgccaacuua ggugaacgug uacgccaagc uuuguuaaaa 13740

acaguacaau ucugugaugc caugcgaaau gcugguauug uugguguacu gacauuagau 13800

aaucaagauc ucaaugguaa cugguaugau uucggugauu ucauacaaac cacgccaggu 13860

aguggaguuc cuguuguaga uucuuauuau ucauuguuaa ugccuauauu aaccuugacc 13920

agggcuuuaa cugcagaguc acauguugac acugacuuaa caaagccuua cauuaagugg 13980

gauuuguuaa aauaugacuu cacggaagag agguuaaaac ucuuugaccg uuauuuuaaa 14040

uauugggauc agacauacca cccaaauugu guuaacuguu uggaugacag augcauucug 14100

cauugugcaa acuuuaaugu uuuauucucu acaguguucc caccuacaag uuuuggacca 14160

cuagugagaa aaauauuugu ugaugguguu ccauuuguag uuucaacugg auaccacuuc 14220

agagagcuag guguuguaca uaaucaggau guaaacuuac auagcucuag acuuaguuuu 14280

aaggaauuac uuguguaugc ugcugacccu gcuaugcacg cugcuucugg uaaucuauua 14340

cuagauaaac gcacuacgug cuuuucagua gcugcacuua cuaacaaugu ugcuuuucaa 14400

acugucaaac ccgguaauuu uaacaaagac uucuaugacu uugcuguguc uaaggguuuc 14460

uuuaaggaag gaaguucugu ugaauuaaaa cacuucuucu uugcucagga ugguaaugcu 14520

gcuaucagcg auuaugacua cuaucguuau aaucuaccaa caauguguga uaucagacaa 14580

cuacuauuug uaguugaagu uguugauaag uacuuugauu guuacgaugg uggcuguauu 14640

aaugcuaacc aagucaucgu caacaaccua gacaaaucag cugguuuucc auuuaauaaa 14700

ugggguaagg cuagacuuua uuaugauuca augaguuaug aggaucaaga ugcacuuuuc 14760

gcauauacaa aacguaaugu caucccuacu auaacucaaa ugaaucuuaa guaugccauu 14820

agugcaaaga auagagcucg caccguagcu ggugucucua ucuguaguac uaugaccaau 14880

agacaguuuc aucaaaaauu auugaaauca auagccgcca cuagaggagc uacuguagua 14940

auuggaacaa gcaaauucua uggugguugg cacaacaugu uaaaaacugu uuauagugau 15000

guagaaaacc cucaccuuau ggguugggau uauccuaaau gugauagagc caugccuaac 15060

augcuuagaa uuauggccuc acuuguucuu gcucgcaaac auacaacgug uuguagcuug 15120

ucacaccguu ucuauagauu agcuaaugag ugugcucaag uauugaguga aauggucaug 15180

uguggcgguu cacuauaugu uaaaccaggu ggaaccucau caggagaugc cacaacugcu 15240

uaugcuaaua guguuuuuaa cauuugucaa gcugucacgg ccaauguuaa ugcacuuuua 15300

ucuacugaug guaacaaaau ugccgauaag uauguccgca auuuacaaca cagacuuuau 15360

gagugucucu auagaaauag agauguugac acagacuuug ugaaugaguu uuacgcauau 15420

uugcguaaac auuucucaau gaugauacuc ucugacgaug cuguugugug uuucaauagc 15480

acuuaugcau cucaaggucu aguggcuagc auaaagaacu uuaagucagu ucuuuauuau 15540

caaaacaaug uuuuuauguc ugaagcaaaa uguuggacug agacugaccu uacuaaagga 15600

ccucaugaau uuugcucuca acauacaaug cuaguuaaac agggugauga uuauguguac 15660

cuuccuuacc cagauccauc aagaauccua ggggccggcu guuuuguaga ugauaucgua 15720

aaaacagaug guacacuuau gauugaacgg uucgugucuu uagcuauaga ugcuuaccca 15780

cuuacuaaac auccuaauca ggaguaugcu gaugucuuuc auuuguacuu acaauacaua 15840

agaaagcuac augaugaguu aacaggacac auguuagaca uguauucugu uaugcuuacu 15900

aaugauaaca cuucaaggua uugggaaccu gaguuuuaug aggcuaugua cacaccgcau 15960

acagucuuac aggcuguugg ggcuuguguu cuuugcaauu cacagacuuc auuaagaugu 16020

ggugcuugca uacguagacc auucuuaugu uguaaaugcu guuacgacca ugucauauca 16080

acaucacaua aauuagucuu gucuguuaau ccguauguuu gcaaugcucc agguugugau 16140

gucacagaug ugacucaacu uuacuuagga gguaugagcu auuauuguaa aucacauaaa 16200

ccacccauua guuuuccauu gugugcuaau ggacaaguuu uugguuuaua uaaaaauaca 16260

uguguuggua gcgauaaugu uacugacuuu aaugcaauug caacauguga cuggacaaau 16320

gcuggugauu acauuuuagc uaacaccugu acugaaagac ucaagcuuuu ugcagcagaa 16380

acgcucaaag cuacugagga gacauuuaaa cugucuuaug guauugcuac uguacgugaa 16440

gugcugucug acagagaauu acaucuuuca ugggaaguug guaaaccuag accaccacuu 16500

aaccgaaauu augucuuuac ugguuaucgu guaacuaaaa acaguaaagu acaaauagga 16560

gaguacaccu uugaaaaagg ugacuauggu gaugcuguug uuuaccgagg uacaacaacu 16620

uacaaauuaa auguugguga uuauuuugug cugacaucac auacaguaau gccauuaagu 16680

gcaccuacac uagugccaca agagcacuau guuagaauua cuggcuuaua cccaacacuc 16740

aauaucucag augaguuuuc uagcaauguu gcaaauuauc aaaagguugg uaugcaaaag 16800

uauucuacac uccagggacc accugguacu gguaagaguc auuuugcuau uggccuagcu 16860

cucuacuacc cuucugcucg cauaguguau acagcuugcu cucaugccgc uguugaugca 16920

cuaugugaga aggcauuaaa auauuugccu auagauaaau guaguagaau uauaccugca 16980

cgugcucgug uagaguguuu ugauaaauuc aaagugaauu caacauuaga acaguauguc 17040

uuuuguacug uaaaugcauu gccugagacg acagcagaua uaguugucuu ugaugaaauu 17100

ucaauggcca caaauuauga uuugaguguu gucaaugcca gauuacgugc uaagcacuau 17160

guguacauug gcgacccugc ucaauuaccu gcaccacgca cauugcuaac uaagggcaca 17220

cuagaaccag aauauuucaa uucagugugu agacuuauga aaacuauagg uccagacaug 17280

uuccucggaa cuugucggcg uuguccugcu gaaauuguug acacugugag ugcuuugguu 17340

uaugauaaua agcuuaaagc acauaaagac aaaucagcuc aaugcuuuaa aauguuuuau 17400

aaggguguua ucacgcauga uguuucaucu gcaauuaaca ggccacaaau aggcguggua 17460

agagaauucc uuacacguaa cccugcuugg agaaaagcug ucuuuauuuc accuuauaau 17520

ucacagaaug cuguagccuc aaagauuuug ggacuaccaa cucaaacugu ugauucauca 17580

cagggcucag aauaugacua ugucauauuc acucaaacca cugaaacagc ucacucuugu 17640

aauguaaaca gauuuaaugu ugcuauuacc agagcaaaag uaggcauacu uugcauaaug 17700

ucugauagag accuuuauga caaguugcaa uuuacaaguc uugaaauucc acguaggaau 17760

guggcaacuu uacaagcuga aaauguaaca ggacucuuua aagauuguag uaagguaauc 17820

acuggguuac auccuacaca ggcaccuaca caccucagug uugacacuaa auucaaaacu 17880

gaagguuuau guguugacau accuggcaua ccuaaggaca ugaccuauag aagacucauc 17940

ucuaugaugg guuuuaaaau gaauuaucaa guuaaugguu acccuaacau guuuaucacc 18000

cgcgaagaag cuauaagaca uguacgugca uggauuggcu ucgaugucga ggggugucau 18060

gcuacuagag aagcuguugg uaccaauuua ccuuuacagc uagguuuuuc uacagguguu 18120

aaccuaguug cuguaccuac agguuauguu gauacaccua auaauacaga uuuuuccaga 18180

guuagugcua aaccaccgcc uggagaucaa uuuaaacacc ucauaccacu uauguacaaa 18240

ggacuuccuu ggaauguagu gcguauaaag auuguacaaa uguuaaguga cacacuuaaa 18300

aaucucucug acagagucgu auuugucuua ugggcacaug gcuuugaguu gacaucuaug 18360

aaguauuuug ugaaaauagg accugagcgc accuguuguc uaugugauag acgugccaca 18420

ugcuuuucca cugcuucaga cacuuaugcc uguuggcauc auucuauugg auuugauuac 18480

gucuauaauc cguuuaugau ugauguucaa caaugggguu uuacagguaa ccuacaaagc 18540

aaccaugauc uguauuguca aguccauggu aaugcacaug uagcuaguug ugaugcaauc 18600

augacuaggu gucuagcugu ccacgagugc uuuguuaagc guguugacug gacuauugaa 18660

uauccuauaa uuggugauga acugaagauu aaugcggcuu guagaaaggu ucaacacaug 18720

guuguuaaag cugcauuauu agcagacaaa uucccaguuc uucacgacau ugguaacccu 18780

aaagcuauua aguguguacc ucaagcugau guagaaugga aguucuauga ugcacagccu 18840

uguagugaca aagcuuauaa aauagaagaa uuauucuauu cuuaugccac acauucugac 18900

aaauucacag augguguaug ccuauuuugg aauugcaaug ucgauagaua uccugcuaau 18960

uccauuguuu guagauuuga cacuagagug cuaucuaacc uuaacuugcc ugguugugau 19020

gguggcaguu uguauguaaa uaaacaugca uuccacacac cagcuuuuga uaaaagugcu 19080

uuuguuaauu uaaaacaauu accauuuuuc uauuacucug acaguccaug ugagucucau 19140

ggaaaacaag uagugucaga uauagauuau guaccacuaa agucugcuac guguauaaca 19200

cguugcaauu uagguggugc ugucuguaga caucaugcua augaguacag auuguaucuc 19260

gaugcuuaua acaugaugau cucagcuggc uuuagcuugu ggguuuacaa acaauuugau 19320

acuuauaacc ucuggaacac uuuuacaaga cuucagaguu uagaaaaugu ggcuuuuaau 19380

guuguaaaua agggacacuu ugauggacaa cagggugaag uaccaguuuc uaucauuaau 19440

aacacuguuu acacaaaagu ugaugguguu gauguagaau uguuugaaaa uaaaacaaca 19500

uuaccuguua auguagcauu ugagcuuugg gcuaagcgca acauuaaacc aguaccagag 19560

gugaaaauac ucaauaauuu ggguguggac auugcugcua auacugugau cugggacuac 19620

aaaagagaug cuccagcaca uauaucuacu auugguguuu guucuaugac ugacauagcc 19680

aagaaaccaa cugaaacgau uugugcacca cucacugucu uuuuugaugg uagaguugau 19740

ggucaaguag acuuauuuag aaaugcccgu aaugguguuc uuauuacaga agguaguguu 19800

aaagguuuac aaccaucugu aggucccaaa caagcuaguc uuaauggagu cacauuaauu 19860

ggagaagccg uaaaaacaca guucaauuau uauaagaaag uugauggugu uguccaacaa 19920

uuaccugaaa cuuacuuuac ucagaguaga aauuuacaag aauuuaaacc caggagucaa 19980

auggaaauug auuucuuaga auuagcuaug gaugaauuca uugaacggua uaaauuagaa 20040

ggcuaugccu ucgaacauau cguuuaugga gauuuuaguc auagucaguu aggugguuua 20100

caucuacuga uuggacuagc uaaacguuuu aaggaaucac cuuuugaauu agaagauuuu 20160

auuccuaugg acaguacagu uaaaaacuau uucauaacag augcgcaaac agguucaucu 20220

aagugugugu guucuguuau ugauuuauua cuugaugauu uuguugaaau aauaaaaucc 20280

caagauuuau cuguaguuuc uaagguuguc aaagugacua uugacuauac agaaauuuca 20340

uuuaugcuuu gguguaaaga uggccaugua gaaacauuuu acccaaaauu acaaucuagu 20400

caagcguggc aaccgggugu ugcuaugccu aaucuuuaca aaaugcaaag aaugcuauua 20460

gaaaagugug accuucaaaa uuauggugau agugcaacau uaccuaaagg cauaaugaug 20520

aaugucgcaa aauauacuca acugugucaa uauuuaaaca cauuaacauu agcuguaccc 20580

uauaauauga gaguuauaca uuuuggugcu gguucugaua aaggaguugc accagguaca 20640

gcuguuuuaa gacagugguu gccuacgggu acgcugcuug ucgauucaga ucuuaaugac 20700

uuugucucug augcagauuc aacuuugauu ggugauugug caacuguaca uacagcuaau 20760

aaaugggauc ucauuauuag ugauauguac gacccuaaga cuaaaaaugu uacaaaagaa 20820

aaugacucua aagaggguuu uuucacuuac auuugugggu uuauacaaca aaagcuagcu 20880

cuuggagguu ccguggcuau aaagauaaca gaacauucuu ggaaugcuga ucuuuauaag 20940

cucaugggac acuucgcaug guggacagcc uuuguuacua augugaaugc gucaucaucu 21000

gaagcauuuu uaauuggaug uaauuaucuu ggcaaaccac gcgaacaaau agaugguuau 21060

gucaugcaug caaauuacau auuuuggagg aauacaaauc caauucaguu gucuuccuau 21120

ucuuuauuug acaugaguaa auuuccccuu aaauuaaggg guacugcugu uaugucuuua 21180

aaagaagguc aaaucaauga uaugauuuua ucucuucuua guaaagguag acuuauaauu 21240

agagaaaaca acagaguugu uauuucuagu gauguucuug uuaacaacua a 21291

Two large replicase polyproteins, pp1a and pp1ab, which are encoded by ORF1ab, are proteolytically cleaved into 16 putative non-structural proteins (nsps) (Chan et al., “Genomic Characterization of the 2019 Novel Human-Pathogenic Coronavirus Isolated from a Patient with Atypical Pneumonia After Visiting Wuhan,” Emer. Microbes Infect. 9(1):221-236 (2020), which is hereby incorporated by reference in its entirety). These putative nsps include two viral cysteine proteases, namely, nsp3 (papain-like protease) and nsp5 (chymotrypsin-like, 3C-like, or main protease), along with nsp12 (RNA-dependent RNA polymerase [RARp]), nsp13 (helicase), and other nsps which are likely involved in the transcription and replication of the virus (Chan et al., “Genomic Characterization of the 2019 Novel Human-Pathogenic Coronavirus Isolated from a Patient with Atypical Pneumonia After Visiting Wuhan,” Emer. Microbes Infect. 9(1):221-236 (2020), which is hereby incorporated by reference in its entirety). The nsp4 encoding region, containing the transmembrane 2 domain (TM2) gene (see Snij der et al., “Unique and Conserved Features of Genome and Proteome of SARS-coronavirus, an Early Split-Off from the Coronavirus Group 2 Lineage,” J. Mol. Biol. 331(5):99-1004 (2003), which is hereby incorporated by reference in its entirety), is the region of SARS-CoV-2 detected using the methods described herein. The TM2 gene has the nucleotide sequence of SEQ ID NO: 12, which shows enough variabilities (relative to other viral gene sequences) to be specific to SARS-CoV-2. Thus, detection of the TM2 gene is selective for the detection of SARS-COV-2.

ggauacaacuagcuacagagaagcugcuuguugucaucucgcaaaggcucucaaugacuucaguaacucagguucugaugu (SEQ ID NO: 12)

In some embodiments, the method described herein involves the detection of the TM2 gene of SARS-CoV-2 alone. In some embodiments, the methods described herein involve the detection of the TM2 gene of SARS-CoV-2 in conjunction with the detection of at least one other region of SARS-CoV-2. In some embodiments, the second region of the SARS-CoV-2 RNA detected is a region within the N gene. Thus, one aspect of the present disclosure is directed to a method of detecting the presence or absence of SARS-CoV-2 in a sample that involves contacting the sample with the primary oligonucleotide primer set complementary to the TM2 gene of ORF1a together with at least a secondary oligonucleotide primer set. The secondary oligonucleotide primer set comprises (i) a first oligonucleotide primer comprising a nucleotide sequence complementary to a first portion of the SARS-CoV-2 N gene, and (ii) a second oligonucleotide primer comprising a nucleotide sequence complementary to an extension product formed from the first oligonucleotide primer of the secondary oligonucleotide primer set.

The nucleotide sequence of the N gene is provided below as SEQ ID NO:11 (Genbank Accession No. NC_045512 (28274 . . . 29533); Gene ID No. 43740575):

1
augucugaua auggacccca aaaucagcga

aaugcacccc gcauuacguu ugguggaccc

61
ucagauucaa cuggcaguaa ccagaaugga

gaacgcagug gggcgcgauc aaaacaacgu

121
cggccccaag guuuacccaa uaauacugcg

ucuugguuca ccgcucucac ucaacauggc

181
aaggaagacc uuaaauuccc ucgaggacaa

ggcguuccaa uuaacaccaa uagcagucca

241
gaugaccaaa uuggcuacua ccgaagagcu

accagacgaa uucguggugg ugacgguaaa

301
augaaagauc ucaguccaag augguauuuc

uacuaccuag gaacugggcc agaagcugga

361
cuucccuaug gugcuaacaa agacggcauc

auauggguug caacugaggg agccuugaau

421
acaccaaaag aucacauugg cacccgcaau

ccugcuaaca augcugcaau cgugcuacaa

481
cuuccucaag gaacaacauu gccaaaaggc

uucuacgcag aagggagcag aggcggcagu

541
caagccucuu cucguuccuc aucacguagu

cgcaacaguu caagaaauuc aacuccaggc

601
agcaguaggg gaacuucucc ugcuagaaug

gcuggcaaug gcggugaugc ugcucuugcu

661
uugcugcugc uugacagauu gaaccagcuu

gagagcaaaa ugucugguaa aggccaacaa

721
caacaaggcc aaacugucac uaagaaaucu

gcugcugagg cuucuaagaa gccucggcaa

781
aaacguacug ccacuaaagc auacaaugua

acacaagcuu ucggcagacg ugguccagaa

841
caaacccaag gaaauuuugg ggaccaggaa

cuaaucagac aaggaacuga uuacaaacau

901
uggccgcaaa uugcacaauu ugcccccagc

gcuucagcgu ucuucggaau gucgcgcauu

961
ggcauggaag ucacaccuuc gggaacgugg

uugaccuaca caggugccau caaauuggau

1021
gacaaagauc caaauuucaa agaucaaguc

auuuugcuga auaagcauau ugacgcauac

1081
aaaacauucc caccaacaga gccuaaaaag

gacaaaaaga agaaggcuga ugaaacucaa

1141
gccuuaccgc agagacagaa gaaacagcaa

acugugacuc uucuuccugc ugcagauuug

1201
gaugauuucu ccaaacaauu gcaacaaucc

augagcagug cugacucaac ucaggccuaa

As used herein, an “oligonucleotide primer” refers to a nucleic acid molecule that hybridizes in a sequence specific manner to a complementary nucleic acid molecule (i.e., a target nucleic acid molecule) and is capable of initiating template-directed synthesis using methods such as polymerase chain reaction (PCR) under appropriate conditions (e.g., in the presence of four nucleotide triphosphates and a polymerase enzyme, such as DNA polymerase, reverse-transcriptase, etc., in an appropriate buffer solution containing any necessary reagents and at suitable temperature(s)). Such template directed synthesis is called primer extension and results in the generation of a primer extension product.

The oligonucleotide primers of the present disclosure can be in the form of ribonucleotides, deoxynucleotides, modified ribonucleotides, modified deoxyribonucleotides, modified phosphate-sugar-backbone oligonucleotides, nucleotide analogs, and mixtures thereof. In some embodiments, the oligonucleotide primers are single-stranded deoxyribonucleic acid (DNA) molecules. In some embodiments, primers utilized in the methods described herein to detect the presence or absence of SARS-CoV-2 are each at least 10 nucleotides in length. In some embodiments, the primers are at least about 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides in length. Preferably, the guanine/cytosine (GC) ratio of the primer sequence is above 30%, above 35%, above 40%, above 45%, above 50%, above 55%, or above 60% so as to prevent hair-pin formation of the primer. The primers utilized in the methods described herein may be prepared using any suitable method, such as conventional phosphotriester and phosphodiester methods or automated embodiments thereof so long as the primers are capable of hybridizing to their target nucleotide sequences of interest. The exact length of primer will depend on many factors, including temperature, buffer, and nucleotide composition within a reaction mixture.

Primers of the present disclosure comprise a nucleotide sequence that is complementary or substantially complementary to a “target nucleotide sequence”. In some embodiments, the target nucleotide sequence comprises a nucleotide sequence portion of SARS-CoV-2 genomic RNA, e.g., a nucleotide sequence of the TM2 gene or N gene of SARS-CoV-2. In some embodiments, the target nucleotide sequence comprises a complementary sequence of the SARS-CoV-genomic RNA, e.g., a complementary DNA (cDNA) of the SARS-CoV-2 genomic RNA formed in a reverse transcription reaction. In some embodiments, the target nucleotide sequence comprises a sequence within a primer extension product formed from a primer of the present disclosure.

The terms “complementary” and “substantially complementary” refer to base pairing between nucleotides such as, for instance, between an oligonucleotide primer and its target nucleotide sequence. Complementary nucleotides are, generally, adenine and thymine, adenosine and uracil, and guanine and cytosine. Within the context of the methods disclosed herein, the oligonucleotide primers do not require complete complementarity in order to hybridize to their target nucleotide sequence. The primer sequences disclosed herein may be modified to some extent without loss of utility as specific primers. In accordance with the methods of the present disclosure, the first and second oligonucleotide primers of the primary and secondary primer set are at least 80% complementary to their target nucleotide sequence. In some embodiments, the oligonucleotide primers disclosed herein are at least 85%, at least 90%, at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% complementary to their target nucleotide sequence.

As is known in the art, hybridization of complementary and partially complementary nucleic acid sequences may be obtained by adjustment of the hybridization conditions to increase or decrease stringency, i.e., by adjustment of hybridization temperature or salt content of the buffer. Minor modifications of the disclosed sequences and any necessary adjustments of hybridization conditions to maintain specificity require only routine experimentation and are within the ordinary skill in the art. In some embodiments, a primer will comprise a nucleotide sequence that hybridizes to at least about 8, at least about 10, at least about 15, or about 20 to about 40 consecutive nucleotides of a target nucleic acid (i.e., the primer sequence will hybridize to a contiguous sequence within a target nucleic acid). Nucleic acid molecules that are complementary to each other can hybridize to each other under stringent conditions that are low, moderate, and/or high.

The oligonucleotide primers as disclosed herein are not naturally occurring genomic sequences, and thus, are not products of nature. The SARS-CoV-2 genome consists of a positive-sense, single strand RNA. From the full-length genomic RNA, ORF1a and ORF1b polyproteins are directly translated (i.e., no intermediate complement of the genomic RNA is produced), while translation of some or all of the structural proteins involves the production of subgenomic RNAs via discontinuous transcription events. Since the viral genome and any subgenomic RNA fragments are comprised of ribose nucleotides (i.e., ribose sugars appended to one of cytosine, guanine, adenine, and uracil nucleobases), the oligonucleotide primers described herein, which are comprised of deoxyribose nucleotides (i.e., deoxyribose sugars appended to one of cytosine, guanine, adenine, and thymine nucleobases) are structurally unique molecules that do not exist in nature.

Oligonucleotide primer pairs as described herein are designed to delineate and amplify particular regions of the SARS-CoV-2 genome using an amplification reaction such as PCR or Real Time-PCR. These exemplary amplification reactions comprise either two or three step cycles. Two step cycles have a high temperature denaturation step followed by a hybridization/elongation step. Three step cycles comprise a denaturation step, a hybridization step, and a separate elongation step. During the hybridization step, the first and/or second oligonucleotide primers of one or more primer sets as described herein hybridize to their respective target nucleotide sequence, and during the elongation step, the primers are extended to form primer extension products. The primer extension product of one primer is designed to serve as target nucleotide sequence for the other primer of the primer set in the amplification reaction. Thus, repetition of the reaction cycles results in exponential amplification of the target region, i.e., a region of the TM2 gene and/or region of the N gene of SARS-CoV-2, encompassed by primers. This target region, defined on its 5′end by the first or second primer nucleotide sequence and defined on its 3′ end by the complement of the second or first primer nucleotide sequence, respectively, is referred to herein as the amplification product or amplicon. In some embodiments, the amplification products generated in accordance with the methods described here are nucleic acid molecules that are at least 20 nucleotides in length. In some embodiments, the amplification products are 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, or greater than 100 nucleotides in length.

Various nucleic acid amplification reactions are well known in the art and suitable for use in the methods of the present disclosure. These nucleic acid amplification reactions include, without limitation, PCR (U.S. Pat. No. 5,219,727, which is hereby incorporated by reference in its entirety) as described above and its variants such as in situ polymerase chain reaction (U.S. Pat. No. 5,538,871, which is hereby incorporated by reference in its entirety), quantitative polymerase chain reaction (U.S. Pat. No. 5,219,727, which is hereby incorporated by reference in its entirety), nested polymerase chain reaction (U.S. Pat. No. 5,556,773, which is hereby incorporated by reference in its entirety), self-sustained sequence replication and its variants (Guatelli et al. “Isothermal, In vitro Amplification of Nucleic Acids by a Multienzyme Reaction Modeled after Retroviral Replication,” Proc Natl Acad Sci USA 87(5): 1874-8 (1990), which is hereby incorporated by reference in its entirety), transcriptional amplification and its variants (Kwoh et al. “Transcription-based Amplification System and Detection of Amplified Human Immunodeficiency Virus type 1 with a Bead-Based Sandwich Hybridization Format,” Proc Natl Acad Sci USA 86(4): 1173-7 (1989), which is hereby incorporated by reference in its entirety), Qb Replicase and its variants (Miele et al. “Autocatalytic Replication of a Recombinant RNA.” J Mol Biol 171(3): 281-95 (1983), which is hereby incorporated by reference in its entirety), cold-PCR (Li et al. “Replacing PCR with COLD-PCR Enriches Variant DNA Sequences and Redefines the Sensitivity of Genetic Testing.” Nat Med 14(5): 579-84 (2008), which is hereby incorporated by reference in its entirety). Depending on the amplification technique that is employed, the amplified molecules are detected during amplification (e.g., real-time PCR) or subsequent to amplification and may involve detection of labeled amplification product, detection of component comprising amplified nucleic acid, or a byproduct of the amplification process, such as a physical, chemical, luminescence, or electrical aspect, which correlates with amplification (e.g. fluorescence, pH change, heat change, etc.). Suitable nucleic acid detection assays are described in more detail below.

In some embodiments, the nucleic acid amplification reaction employed in the method of the present disclosure is a real-time PCR. Real-time PCR, which is also referred to quantitative real time polymerase chain reaction or kinetic polymerase chain reaction, is used to amplify and simultaneously quantify one or more nucleic acid molecules present in a sample. It enables both detection and quantification (as absolute number of copies or relative amount when normalized to nucleic acid input or additional normalizing genes) of a specific sequence in a sample. Real-time PCR may be combined with reverse transcription polymerase chain reaction to quantify RNAs (real-time RT-PCR). Relative concentrations of a particular nucleic acid present during the exponential phase of real-time PCR are determined by plotting fluorescence (generated with the production of an amplification product) against cycle number on a logarithmic scale. Amounts of one or more nucleic acid molecules present in the sample are determined by comparing the results to a standard curve produced by real-time PCR of serial dilutions of a known amount of nucleic acid.

In some embodiments, the amplification reaction is carried out in a “multiplex” manner to detect the presence or absence of SARS-CoV-2 in a sample. The term “multiplex” refers to multiple assays being carried out simultaneously (i.e., in one reaction tube), in which detection and analysis steps are generally performed in parallel. Within the context of the present disclosure, a multiplex assay involves the use of the primary oligonucleotide primer set as described herein in combination with one or more additional oligonucleotide primer sets, e.g., the secondary oligonucleotide primer set and a control oligonucleotide primer set as described herein to identify two or more regions of the SARS-CoV-2 RNA in a sample simultaneously.

In accordance with the methods disclosed herein, the first oligonucleotide primer of the primary primer set comprises a nucleotide sequence that is complementary to a portion of the TM2 gene of ORF1a of SARS-CoV-2. As described above, the TM2 gene has a nucleotide sequence of SEQ ID NO: 12 (corresponding to nucleotides 9663-9743 of the ORF1ab region provided above as SEQ ID NO: 10). In some embodiments, an exemplary first oligonucleotide primer of the primary primer set comprises a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence of GGATACAACTAGCTACAGAGAA (SEQ ID NO: 1). As used herein, the term “sequence identity” defines the amount of continuous nucleotide residues which match exactly between two different sequences, wherein the measurement is relational to the shorter of the two sequences. In some embodiments, the first oligonucleotide primer of the primary primer set comprises a nucleotide sequence having at least 95%, at least 96%, at least 97%, and least 98%, and least 99% sequence identity to the nucleotide sequence of SEQ ID NO: 1. In some embodiments, the first oligonucleotide primer of the primary primer set comprises a nucleotide sequence of SEQ ID NO: 1.

In some embodiments, an exemplary second oligonucleotide primer of the primary primer set comprises a nucleotide sequence that is complementary to the primer extension product formed from the first oligonucleotide primer of the primary primer set as described herein. In some embodiments, the second oligonucleotide primer of the primary primer set comprises a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence of CATCAGAACCTGAGTTACTGAA (SEQ ID NO: 2). In some embodiments, the second oligonucleotide primer of the primary primer set comprises a nucleotide sequence having at least 95%, at least 96%, at least 97%, and least 98%, and least 99% sequence identity to the nucleotide sequence of SEQ ID NO: 2. In some embodiments, the second oligonucleotide primer of the primary primer set comprises a nucleotide sequence of SEQ ID NO: 2.

In accordance with the methods disclosed herein, the first oligonucleotide primer of the secondary primer set comprises a nucleotide sequence that is complementary to a portion of the N gene of SARS-CoV-2 genomic RNA, i.e., complementary to a portion of the nucleotide sequence of SEQ ID NO: 11. In some embodiments, an exemplary first oligonucleotide primer of the secondary primer set comprises a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence of AACGTGGTTGACCTACAC (SEQ ID NO: 4). In some embodiments, the first oligonucleotide primer of the secondary primer set comprises a nucleotide sequence having at least 95%, at least 96%, at least 97%, and least 98%, and least 99% sequence identity to the nucleotide sequence of SEQ ID NO: 4. In some embodiments, the first oligonucleotide primer of the secondary primer set comprises a nucleotide sequence of SEQ ID NO: 4.

In some embodiments, an exemplary second oligonucleotide primer of the secondary primer set comprises a nucleotide sequence that is complementary to the primer extension product formed from the first oligonucleotide primer of the secondary primer set as described herein. In some embodiments, the second oligonucleotide primer of the secondary primer set comprises a nucleotide sequence having at least 90% sequence identity to the nucleotide sequence of GCTTATTCAGCAAAATGACTTGA (SEQ ID NO: 5). In some embodiments, the second oligonucleotide primer of the secondary primer set comprises a nucleotide sequence having at least 95%, at least 96%, at least 97%, and least 98%, and least 99% sequence identity to the nucleotide sequence of SEQ ID NO: 5. In some embodiments, the second oligonucleotide primer of the secondary primer set comprises a nucleotide sequence of SEQ ID NO: 5.

In some embodiments, at least one oligonucleotide primer of the primary primer set and/or the secondary primer set comprises a detectable label. The detectable label can be covalently or non-covalently coupled to the 5′ end of the primer. Suitable detectable labels are disclosed herein. In accordance with this embodiment, the detectable label is incorporated into the amplification products formed from the first and second primers of the primer set, and the presence or absence of SARS-CoV-2 is detected by detecting labeled TM2 and/or N gene amplification products.

In some embodiments, the primary oligonucleotide primer set and/or the secondary oligonucleotide primer set as described above each further comprise an oligonucleotide probe. The term “probe” as used herein refers to an oligonucleotide that produce a detectable response upon interaction with a target nucleotide sequence. In some embodiments, the oligonucleotide probe of the primary oligonucleotide primer set as disclosed herein includes at least one reporter moiety, and a nucleotide sequence complementary to a TM2 amplification product formed from the first and second primers of the primary oligonucleotide primer set. In some embodiments, the oligonucleotide probe of the secondary oligonucleotide primer set comprises at least one reporter moiety, and a nucleotide sequence complementary to an N gene amplification product formed from the first and second primers of the secondary primer set.

In some embodiments, the oligonucleotide probes comprise a pair of moieties that form an energy transfer pair detectable upon some change of state of the probe in response to its interaction with a binding partner. In some embodiments, the oligonucleotide probes described herein comprise more than two moieties such as a fluorophore and one or more quencher moieties. In accordance with the methods of the present disclosure, the probes hybridize to complementary regions of their respective amplification products, and the presence of SARS-CoV-2 in a sample is determined by detecting the one or more reporter moieties or interaction between the reporter moieties of the oligonucleotide probes during or after the amplification reaction.

In some embodiments, the oligonucleotide probe of the primary primer set comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence of CTGCTTGTTGTCATCTCGCAAAG (SEQ ID NO: 3). In some embodiments, the oligonucleotide probe of the secondary primer set comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence of CCATCAAATTGGATGACAAAGATCCAAATT (SEQ ID NO: 6).

As used herein, “detectable label” or “reporter moiety” encompasses any molecule that provides a detectable signal, and that can be coupled to an oligonucleotide primer or probe as described herein. Numerous detectable labels that may be used to label nucleic acids are known in the art. Direct reporter molecules include fluorophores, chromophores, and radiophores. Non-limiting examples of fluorophores include, a red fluorescent squarine dye such as e.g., 2,4-Bis[1,3,3-trimethyl-2-indolinylidenemethyl]cyclobutenediylium-1,3-dioxolate, an infrared dye, e.g., 2,4Bis[3,3-dimethyl-2-(1H-benz[e]indolinylidenemethyl)]cyclobutenediylium-1,3-dioxolate, or an orange fluorescent squarine dye such as, e.g., 2,4-Bis[3,5-dimethyl-2-pyrrolyl]cyclobutenediylium-1,3-diololate. Additional non-limiting examples of fluorophores include quantum dots, Alexa Fluor® dyes, AMCA, BODIPY® 630/650, BODIPY® 650/665, BODIPY®-FL, BODIPY®-R6G, BODIPY®-TMR, BODIPY®-TRX, Cascade Blue®, CyDye™, including but not limited to Cy2™, Cy3™, and Cy5™, a DNA intercalating dye, 6-FAM™, Fluorescein, HEX™, 6-JOE, Oregon Green® 488, Oregon Green® 500, Oregon Green® 514, Pacific Blue™, REG, phycobilliproteins including, but not limited to, phycoerythrin and allophycocyanin, Rhodamine Green™, Rhodamine Red™, ROX™ TAMRA™, TET™, Tetramethylrhodamine, or Texas Red®. Suitable detectable labels also include indirect reporter molecules, such as biotin, which must be bound to another molecule such as streptavidin-phycoerythrin for detection. In a multiplex reaction, the reporter moiety or detectable label coupled to the primers or probes may be the same for each target nucleic acid molecule in the multiplex reaction being detected if the identities of the amplification products can be determined based on another feature, e.g., size or specific location or identity on a solid support to which they hybridize. Alternatively, the reporter moiety or detectable label coupled to the primers and probes of a multiplex reaction may be different for each different target nucleic acid molecule being detected.

In some embodiments, fluorophore/quencher-based detection systems are utilized in the methods and compositions disclosed herein. In accordance with this embodiment, the oligonucleotide probe of the primary and/or secondary oligonucleotide primer set comprises both a reporter moiety and one or more quencher moieties. The reporter and quencher moieties are in proximity to each other such that the quencher quenches the signal produced by the reporter moiety. In some embodiments, a conformational change in the nucleic acid molecule separates the reporter moiety and quencher to allow the reporter moiety to emit a detectable signal. In some embodiments, cleavage of the reporter moiety or the quencher from the nucleic acid molecule (e.g., by polymerase extension of a primer sequence) separates the reporter from the quencher to allow the reporter moiety to emit a detectable signal. Reporter moiety/quencher-based detection systems reduce background and therefore improve the sensitivity of multiplex reactions such as those disclosed herein.

In particular embodiments, molecules useful as quenchers include, but are not limited to tetramethylrhodamine (TAMRA), DABCYL (DABSYL, DABMI or methyl red) anthroquinone, nitrothiazole, nitroimidazole, malachite green, Black Hole Quenchers®, e.g., BHQ1 (Biosearch Technologies), Iowa Black® or ZEN quenchers (from Integrated DNA Technologies, Inc.) and TIDE Quenchers (e.g. TID Quencher 2 (TQ2) and TIDE Quencher 3 (TQ3)) (from AAT Bioquest). In one embodiment, the probes used in the methods described herein comprise two quencher molecules, an internal quencher and a 3′ quencher. In accordance with this embodiment, an exemplary probe of the primary primer set comprises a nucleotide sequence with a fluorescent reporter moiety on the 5′ end, an internal quencher and a 3′ quencher, e.g., FAM-CTGCTTGTT-ZEN-GTCATCTCGCAAAG-IBFQ (SEQ ID NO: 3). Similarly, an exemplary probe of the secondary primer set comprises a nucleotide sequence with a fluorescent reporter moiety on the 5′ end, an internal quencher and a 3′ quencher, e.g., FAM-CCATCAAAT-ZEN-TGGATGACAAAGATCCAAATT-IBFQ (SEQ ID NO: 6). In accordance with the above embodiments, the reporter moieties of the oligonucleotide probes of the primary and secondary oligonucleotide primer sets are the same reporter moieties. In some embodiments, the reporter moieties of the oligonucleotide probes of the first and second oligonucleotide primer sets are different reporter moieties.

The reporter and quencher moieties as described herein can be attached to a nucleic acid molecule via a covalent bond or a noncovalent interaction. In some embodiments, the report and/or quencher moiety is attached using a linking moiety. Linking moieties and methodologies for attaching reporter or quencher molecules to the oligonucleotide primers or probes as disclosed herein are well known in the art and include, without limitation, a 3′ thiol group (see e.g., Zuckerman et al, Nucleic Acids Research 15: 5305-5321 (1987), which is hereby incorporated by reference in its entirety); a 3′ sulfhydryl moiety (see e.g., Sharma et al, Nucleic Acids Research 19: 3019 (1991)); a 5′ phosphoamino group via Aminolink™ II available from Applied Biosystems, Foster City, Calif. (see e.g., Giusti et al, PCR Methods and Applications 2: 223-227 (1993), which is hereby incorporated by reference in its entirety); 3′ aminoalkylphosphoryl group (see e.g., U.S. Pat. No. 4,739,044, which is hereby incorporated by reference in its entirety); phosphoramidate linkages, a 5′ mercapto group, and a 3′ amino group (see Agrawal et al., Tetrahedron Letters, 31:1543-1546 (1990); Sproat et al, Nucleic Acids Research 15: 4837 (1987); and Nelson et al, Nucleic Acids Research 17: 7187-7194 (1989) which are hereby incorporated by reference in their entirety).

Suitable oligonucleotide primers and probe detection systems known in the art and suitable for use in the methods disclosed herein include, without limitation, fluorescent intercalation dyes, FRET-based detection methods (U.S. Pat. No. 5,945,283; PCT Publication WO 97/22719; both of which are incorporated by reference in their entireties), Scorpion probe detection systems (Thelwell et al., Nucleic Acids Research 28:3752-3761, 2000, which is hereby incorporated by reference in its entirety), Molecular Beacons (Tyagi et al., Nat. Biotechnol. 14 (3): 303-8 (1996), which is hereby incorporated by reference in its entirety), and TaqMan detection systems (Holland et al., Proc. Nat'l Acad. Sci. USA 88(16): 7276-7280 (1991), which is hereby incorporated by reference in its entirety).

Nucleic acid amplification products produced in accordance with the methods described herein can further be analyzed by any number of techniques to determine the presence of, amount of, or identity of the molecule. Non-limiting examples of these techniques include sequencing, mass determination, and base composition determination. The analysis may identify the sequence of all or a part of the amplified nucleic acid or one or more of its properties or characteristics to reveal the desired information.

In some embodiments, the methods of the present application further involve the incorporation and detection of one or more internal controls. In one embodiment, the internal control is a positive control. A suitable positive control, includes, any non-SARS-CoV RNA or cDNA sequence. For example, a non-SARS-CoV sequence can be an intrinsic component of the sample to be assayed. Alternatively, a non-SARS-CoV sequence(s) is spiked into the sample to be assayed. In one embodiment, the spiked non-SARS-CoV control template is the genomic sequence or a portion thereof of another, non-related virus. In one embodiment, the positive control is the genomic sequence or a portion thereof originating from equine arteritis virus. The positive control is amplified and detected using a control primer set. The control primer set has a first oligonucleotide primer comprising a nucleotide sequence complementary to a first portion of the control nucleic acid template and a second oligonucleotide primer comprising a nucleotide sequence complementary to an extension product formed from the first oligonucleotide primer of the control primer set. The sample containing the control template and control reagents along with the primary and secondary primer sets is subjected to one set of amplification reaction conditions, in the same reaction mixture, for the simultaneous detection of the target regions of interest, i.e., TM2 of ORF1a, N gene, and control template regions.

Another aspect of the present application is directed to an isolated oligonucleotide suitable for detecting severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), wherein the isolated oligonucleotide comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6.

As described in more detail supra, oligonucleotides of the disclosure encompass recombinant oligonucleotides and chemically synthesized oligonucleotides. These oligonucleotides can be in the form of ribonucleotides, deoxynucleotides, modified ribonucleotides, modified deoxyribonucleotides, modified phosphate-sugar-backbone oligonucleotides, nucleotide analogs, and mixtures thereof. In some embodiments, the oligonucleotides are single-stranded DNA molecules. In some embodiments, the oligonucleotides are least 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides in length. Preferably, the guanine/cytosine (GC) ratio of the oligonucleotides is above 30%, above 35%, above 40%, above 45%, above 50%, above 55%, or above 60% so as to prevent hair-pin structures formation. These oligonucleotides can be prepared using suitable methods, such as chemical synthesis, recombinant methods, or both.

Another aspect of the present application is directed to an oligonucleotide primer set for detecting SARS-CoV-2 transmembrane domain 2 gene. This oligonucleotide primer set comprises a first oligonucleotide primer comprising a nucleotide sequence that is complementary to a region of the TM2 gene of SARS-CoV-2, and a second oligonucleotide primer comprising a nucleotide sequence that is complementary to an extension product formed from the first oligonucleotide primer. In some embodiments, the first oligonucleotide primer comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from SEQ ID NO: 1. In some embodiments, the second oligonucleotide primer of the primer set comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from SEQ ID NO: 2. In some embodiments, the oligonucleotide primer set further comprises an oligonucleotide probe. The oligonucleotide probe comprises a nucleotide sequence that is complementary to a primer extension product of the first or second oligonucleotide primers of the primer set. In some embodiments, the oligonucleotide probe comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from SEQ ID NO: 3. As described supra, the oligonucleotide probe may comprise a reporter moiety and at least one quencher molecule. Reporter molecules and quenchers are described supra. In one embodiment, the oligonucleotide probe of this primer set comprises a 5′ fluorescent reporter moiety, an internal quencher molecule, and 3′ quencher molecule.

Another aspect of the present application is directed to an oligonucleotide primer set for detecting SARS-CoV-2 N gene. This oligonucleotide primer set comprises a first oligonucleotide primer comprising a nucleotide sequence that is complementary to a region of the N gene of SARS-CoV-2, and a second oligonucleotide primer comprising a nucleotide sequence that is complementary to an extension product formed from the first oligonucleotide primer. In some embodiments, the first oligonucleotide primer comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from SEQ ID NO: 4. In some embodiments, the second oligonucleotide primer of the primer set comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from SEQ ID NO: 5. In some embodiments, the oligonucleotide primer set further comprises an oligonucleotide probe. The oligonucleotide probe comprises a nucleotides sequence that is complementary to a primer extension product of the first or second oligonucleotide primers of the primer set. In some embodiments, the oligonucleotide probe comprises a nucleotide sequence having at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from SEQ ID NO: 6. As described supra, the oligonucleotide probe may comprise a reporter moiety and at least one quencher molecule. Reporter molecules and quenchers are described supra. In one embodiment, the oligonucleotide probe of this primer set comprises a 5′ fluorescent reporter moiety, an internal quencher molecule, and 3′ quencher molecule.

The invention also encompasses kits for detecting the presence of SARS-CoV-2 in a test sample. Suitable amplification reaction reagents that can be included in a kit may include, for example, one or more of buffers, an enzyme having reverse transcriptase activity, an enzyme having polymerase activity, enzyme cofactors such as magnesium or manganese, salts, nicotinamide adenine dinucleotide (NAD), and deoxynucleoside triphosphates (dNTPs) such as, for example, deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate and deoxythymidine triphosphate, biotinylated dNTPs, suitable for carrying out the amplification reactions.

Depending on the procedure, the kit may further comprise one or more of: wash buffers and/or reagents, hybridization buffers and/or reagents, labeling buffers and/or reagents, and detection means. The buffers and/or reagents included in a kit are preferably optimized for the particular amplification/detection technique for which the kit is intended. Protocols for using these buffers and reagents for performing different steps of the procedure may also be included in the kit.

In some embodiments, the kit comprises a positive control. In some embodiments, a kit comprises a negative control. In some embodiments, a negative control comprises any sequence not subject to amplification by primers useful for the amplification and detection of the TM2 gene of ORF1a or the N gene. Furthermore, the kits may be provided with an internal control as a check on the amplification procedure and to prevent occurrence of false negative test results due to failures in the amplification procedure. An optimal internal control sequence is selected in such a way that it will not compete with amplification and detection of the SARS-CoV-2 target nucleic acid molecules in the amplification reaction. In some embodiments, the internal control may be a sequence originating from a different virus, e.g., the nucleotide sequence encoding equine arteritis virus or one or more genes of the equine arteritis virus.

Kits may also contain reagents for the isolation of nucleic acids from a sample prior to amplification, for example reagents suitable for isolating genomic RNA from the sample.

The reagents may be supplied in a solid (e.g., lyophilized) or liquid form. The kits of the present disclosure optionally comprise different containers (e.g., vial, ampoule, test tube, flask or bottle) for each individual buffer and/or reagent. Each component will generally be suitable as aliquoted in its respective container or provided in a concentrated form. Other containers suitable for conducting certain steps of the amplification/detection assay may also be provided. The individual containers of the kit are preferably maintained in close confinement for commercial sale.

The kit may also comprise instructions for using the amplification reaction reagents, primer sets, and/or primer/probe sets according to the present disclosure. Instructions for using the kit according to one or more methods of the present disclosure may comprise instructions for processing the biological sample, extracting nucleic acid molecules, and/or performing the test; instructions for interpreting the results as well as a notice in the form prescribed by a governmental agency (e.g., FDA) regulating the manufacture, use or sale of test reagents and results.

In one embodiment, the kit comprises an oligonucleotide suitable for detecting severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) as described supra. In some embodiments, the kit comprises the oligonucleotide primer set for detecting SARS-CoV-2 TM2 gene as described supra. In some embodiments, the kit comprises the oligonucleotide primer set for detecting SARS-CoV-2 N gene as described supra. In some embodiments, the kit comprises the oligonucleotide primer set for detecting SARS-CoV-2 TM2 gene and the oligonucleotide primer set for detecting the SARS-CoV-2 N gene as described supra.

In one embodiment, the kit comprises one or more reagents for carrying out a real-time reverse transcription polymerase chain reaction. Exemplary reagents include, without limitation, the primers and probes described herein, an enzyme mix comprising a reverse transcriptase and a DNA polymerase, as well as suitable buffers for the reaction.

EXAMPLES
Example 1: Targeted Regions and Assay Design

The following primers and probes are provided which hybridize to target regions present in SARS-Cov-2 genome to form detectable probe/target hybrids indicating the presence of SARS-CoV-2 in a test sample.

The two SARS-CoV-2 genomic regions targeted by the two different SARS-CoV-2 primer and probe sets are located in ORF1ab region (region coding for the Transmembrane domain 2 (TM2) gene of ORF1a) and in the N gene (coding for the Nucleocapsid phosphoprotein) (FIG. 1). The expected size of the TM2 amplicon is 80 base pairs and the expected size of the N gene amplicon is 83 base pairs.

Both specific probes of SARS-CoV-2 feature a 5′fluorescent reporter FAM dye, an internal ZEN® quencher located between the 9th and 10th base from the reporter FAM dye on the 5′ end of the probe sequence, and a 3′ Iowa Black® dark quencher (IBFQ). The advantage of having an internal quencher is to reduce the distance between the FAM dye and the quencher, and thus in combination with the terminal 3′ quencher, provides a higher degree of quenching and lowers initial background. Having both specific SARS-CoV-2 probes on the same FAM detecting channel is thought to prevent false negative results due to probe binding failure and to guaranty inclusivity of the assay. It also improves the reaction of fluorescence as the second identically labelled probe has an additive effect on the overall reaction fluorescence compared to the single probe assay. This higher fluorescence facilitates the evaluation and interpretation of weak positive specimens (Nagy et al., “Evaluation of TaqMan qPCR System Integrating Two Identically Labelled Hydrolysis Probes in Single Assay,” Scientific Reports 7:41392 (2017); Yip et al., “Use of Dual TaqMan Probes to Increase the Sensitivity of 1-Step Quantitative Reverse Transcription-PCR: Application to the Detection of SARS Coronavirus,” Clinical Chemistry 51(10):1885-1888 (2005), which are hereby incorporated by reference in their entirety).

The mix further includes a primer and probe set to detect a sequence located in the genome of equine arteritis virus (EAV) that serves as internal control (Region targeted of EAV assay (NC_002532): 1843-1976). Specific probe of EAV feature 5′fluorescent reporter CY5 dye and a 3′ Iowa Black® dark quencher (IBRQ).

The table below includes the nucleic acid sequences for all primers and probes used in the assay described herein.

TABLE 1

Final
SEQ

primer/

concentration
ID

description
probe
sequences
(nM)
NO:

SARS-CoV-
forward
AACGTGGTTGA
700
4

2_N_F
primer
CCTACAC

SARS-CoV-
probe
FAM-CCATCA
200
6

2_N_P

AAT-ZEN-

TGGATGACAA

AGATCCAAAT

T-IBFQ

SARS-CoV-
reverse
GCTTATTCAG
700
5

2_N_R
primer
CAAAATGACT

TGA

SARS-CoV-
forward
GGATACAACT
500
1

2 ORF1ab_F
primer
AGCTACAGAG

AA

SARS-CoV-
probe
FAM-CTGCTT
100
3

GTT-ZEN-GT

2 ORF1ab_P

CATCTCGCAA

AG-IBFQ

SARS-CoV-
reverse
CATCAGAACC
500
2

2 ORF1ab_R
primer
TGAGTTACTG

AA

EAV_F
forward
CATCTCTTGC
500
7

primer
TTTGCTCCTT

AG

EAV_P
probe
CGCTGTCAGA
100
9

ACAACATTAT

TGCCCAC

EAV_R
reverse
Cy5-AGCCGC
500
8

primer
ACCTTCACAT

TG-IBRQ

These primers and probes preferentially hybridize to the target nucleic acid derived from SARS-CoV-2 and equine arteritis virus, respectively, under strict hybridization assay conditions.

Example 2: Extraction Procedure

Nucleic acids are isolated and purified from human nasopharyngeal swabs using a commercially available nucleic acid extraction kit for automated extraction with a sample input volume of 200 μL and an elution volume of 55 μL. 2 μL of internal control (IC) is added to each sample and negative control (NC) during the extraction process.

Example 3: qPCR Procedure

A total of 10 μL of the purified nucleic acid is added to a real time RT-PCR reaction mix consisting of primer and probe mix (1.5 μL) (see Table 1 for concentrations used), enzyme mix (RT enzyme and Taq polymerase) (1 μL) and buffer (12.5 μL) and reverse transcribed into cDNA which is then subsequently amplified in an Applied Biosystems® 7500 Real-Time PCR thermocycler. The buffer composition includes Tris, Potassium Chloride, Magnesium Chloride, dATP, dCTP, dGTP, dTTP, recombinant albumin, Trehalose with a pH 8.7. The cycling run profile can be found below. As the assay is a multiplex PCR detecting two genomic regions of SARS-CoV-2 and the internal control, all three targets are amplified at the same time.

The PCR program is as follows: 50° C. for 15 minutes hold, 94° C. for 1-minute hold, 40 cycles of: 94° C. for 8 seconds, and 60° C. for 1 minute.

Example 4: Clinical Performance Assessment

The clinical performance of the SAR-CoV-2 detection assay disclosed herein was established using prospectively collected nasopharyngeal swabs (NPS) and oropharyngeal swabs (OPS). A total of 101 specimens were collected from symptomatic patients with suspicion of COVID-19. The clinical performance study was conducted in a diagnostic laboratory and was evaluated by comparing the results of the method disclosed herein (carried out per the methods of Examples 2 and 3 above) with results obtained using a commercially available SARS-CoV-2 nucleic acid amplification kit (CE-IVD nucleic acid amplification test (NAAT)). The results (summarized in the Tables below) showed an overall diagnostic sensitivity of 100% (95% Confidence Interval: 91.78-100) and an overall diagnostic specificity of 100% (95% Confidence Interval: 93.84-100) for the detection of SARS-CoV-2 in both matrices using SARS-CoV-2 detection assay disclosed herein.

Diagnostic
Pass/fail
Diagnostic
Pass/fail

sensitivity
acceptance
specificity
acceptance

Pathogen
in % (95% CI)
criteria
in % (95% CI)
criteria

SARS-CoV-2
100%
PASS
100%

(91.8-100)

(93.8-100)

Diagnostic sensitivity and specificity obtained by the SARS-CoV-2 detection assay disclosed herein

Diagnostic

Diagnostic

sensitivity
95%
specificity
95%

Sample

Total
Confidence

Total
Confidence

Pathogen
type
Percentage
number
interval
Percentage
number
interval

SARS-CoV-2
NPS
100%
12/12
73.5-100
100%
3/3
29.2-100

OPS
100%
31/31
88.8-100
100%
55/55
93.5-100

Overall
100%
43/43
91.8-100
100%
58/58
93.8-100

A comparative study between SARS-CoV-2 specific assays was conducted to determine sensitivity of the method disclosed herein. In particular, the SARS-CoV-2 detection assay disclosed herein (“Test Method”) was compared to SARS-CoV-2 assays from Seegene (FIG. 2A), Roche (FIG. 2B), and Vircell (FIG. 2C). Individual clinical positive samples were compared and values displayed in the tables of FIGS. 2A-2C correspond to the cycle threshold (Ct) values, i.e., the number of cycles required for the fluorescent signal to exceed background level. When comparing Ct values of the SARS-CoV-2 assay disclosed herein to commercially available SARS-CoV-2 detection assays, the detection assay disclosed herein always produced lower Ct values, indicating better sensitivity per clinical sample than the Ct values obtained with the commercially available SARS-CoV-2 detection assays.

Although preferred embodiments have been depicted and described in detail herein, it will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, and the like can be made without departing from the spirit of the present application and these are therefore considered to be within the scope of the present application as defined in the claims which follow.