2. The Preliminary Binding Affinity of the Compounds Obtained by Computational Screening to the Aptamer were Respectively Determined by Fluorescence Labeling.

PicoGreen® dye is a fluorescent dye that only recognizes and binds to the spiral grooves of double-stranded DNA, and does not bind to single-stranded DNA. After binding to double-stranded DNA, the fluorescence increases. When the aptamer binds with OTA, the remaining unbound aptamers will hybridize with the complementary strand of the aptamer in the reaction system to form double-stranded DNA. PicoGreen® dye recognizes and binds to double-stranded DNA. When different concentrations of a target are bound to a specific concentration of aptamer, the fluorescence intensity is different, and the generated fluorescence is proportional to the DNA concentration. The binding affinity of the aptamer to the target can be characterized by the change of the fluorescence signal.

2.1. Binding affinity test of OBA3 to OTA (control): Using a buffer (pH 7.4) as a diluent, the aptamer OBA3 (25 μL, 1 μmol/L) and 50 μL of different concentrations (0 μM/L, 2 μM/L, and 100 μM/L) of OTA solution were mixed in wells of a microplate. Each solution was incubated at 25° C. for 10 min. Then, a complementary strand DNA3 (25 μL, 1 μmol/L, having a sequence as shown in SEQ ID NO: 8) of the aptamer and 20 μL 5×PG were added to the solution. After incubation for 5 min, the fluorescence intensity was scanned on a microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 525 nm.

2.2. Binding affinity test of OBA3 to target Cyproconazole: Using a buffer (pH 7.4) as a diluent, the aptamer OBA3 (25 μL, 1 μmol/L) and 50 μL of different concentrations (0 μM/L, 2 μM/L, and 100 μM/L) of Cyproconazole solution were mixed in wells of a microplate. Each solution was incubated at 25° C. for 10 min. Then, a complementary strand DNA3 (25 μL, 1 μmol/L) of the aptamer and 20 μL 5×PG were added to the solution. After incubation for 5 min, the fluorescence intensity was scanned on a microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 525 nm.

2.3. The same method as that in Step 2.1 or 2.2 was used, except that the target was replaced respectively by Difloxacin hydrochloride, Norfloxacin, Protopine, Lmiquimod, Hygromycin B, 1,3,7-Trimethyluric acid, Adinazolam, Naratriptan, Rizatriptan, Asenapine, Indacaterol, and Mosapride.

The results are shown in FIG. 1. A total of 14 compounds are tested. Different concentrations (0 μM/L, 2 μM/L, and 100 μM/L) of compounds are bound to the aptamer OBA3. As the target concentration increases, the aptamer binds to the target, so the remaining unbound aptamer decreases, the double-stranded DNA formed by hybridizing with the complementary strand of the aptamer decreases, and the fluorescence intensity decreases. Accordingly, 5 targets with high affinity including Mosapride, Indacaterol, Asenapine, Norfloxacin, and Difloxacin hydrochloride were selected, and the binding parameters were determined by ITC (isothermal titration calorimetry). The test data was fitted by support calculation software to obtain the dissociation constant. FIG. 2 shows the 3D display of the aptamer OBA3 binding to OTA (left) and Norfloxacin (right).

3. Based on the Actual Results in Step 2, the Binding Parameters were Determined by ITC (Isothermal Titration Calorimetry).

ITC is a method in which one reactant is used to titrate another reactant, and the temperature change of the reaction system is measured as the amount of the titrant added changes. In the method, a calorimetric curve of a changing process is continuously and accurately recorded by a highly sensitive and highly automated microcalorimeter, to provide thermodynamic and kinetic information. In this way, complete thermodynamic parameters of biomolecular interactions can be obtained. Time interval: 210 s, stirring speed: 502 RPM, initial delay: 60 s, thermal equilibrium: 25° C. The concentration ratio of the aptamer to small molecule target was 1:5-20.

3.1. Using a buffer as a diluent, the OTA was diluted into a solution with a concentration of 300 μmol/L, and the nucleic acid aptamer OBA3 was diluted into a solution with a concentration of 20 μmol/L. After titration by using an isothermal titration calorimeter, the data was plotted and fitted by support software to obtain the dissociation constant.

3.2. The same method as that in Step 3.1 was used, except that the Norfloxacin was diluted into a solution with a concentration of 330 μmol/L, and the nucleic acid aptamer OBA3 was diluted into a solution with a concentration of 30 μmol/L.

3.3. The same method as that in Step 3.1 was used, except that the Difloxacin hydrochloride was diluted into a solution with a concentration of 300 μmol/L, and the nucleic acid aptamer OBA3 was diluted into a solution with a concentration of 30 μmol/L.

3.4. The same method as that in Step 3.1 was used, except that the Mosapride was diluted into a solution with a concentration of 300 μmol/L, and the nucleic acid aptamer OBA3 was diluted into a solution with a concentration of 30 μmol/L.

3.5. The same method as that in Step 3.1 was used, except that the Asenapine was diluted into a solution with a concentration of 300 μmol/L, and the nucleic acid aptamer OBA3 was diluted into a solution with a concentration of 30 μmol/L.

The experimental results are shown in Table 1 and FIGS. 3-5 (the data and figures are not presented for ones having weak or no binding). The aptamer OBA3 has a dissociation constant of 0.12 μM from the target Norfloxacin, the aptamer OBA3 has a dissociation constant of 0.16 μM from the target Difloxacin hydrochloride, and the aptamer OBA3 has a dissociation constant of 1.25 μM from the target Asenapine. As shown in Table 2, the dissociation constant of the aptamer OBA3 from the target OTA in a previous literature is 1.4 μM, and Mosapride does not bind to OBA3. This indicates that targets with higher affinity to the aptamer OBA3 are screened out.

TABLE 1

Experimental results of aptamer OBA3

binding to different targets by ITC

Target
OTA
Norfloxacin
Difloxacin

Aptamer
OBA3
OBA3
OBA3

Instrument
VP-ITC
VP-ITC
VP-ITC

N (sites)
1.09 ± 0.012
1.06 ± 0.008
1.03 ± 0.006

K (M⁻¹)
5.77E5 ± 4.34E4
7.78E6 ± 1.60E6
6.29E6 ± 9.15E5

K_d(μmol/L)
1.73
0.13
0.16

TABLE 2

Sequences of various aptamers for OTA and

disassociation constants

Name
Sequence
Kd (μM)

OBAwt
GGGGTGAAACGGGTCCCG
81 ± 2

(SEQ ID NO: 10)

OBA1
CGGGGTGAAACGGGTCCCG
5.9 ± 0.1

(SEQ ID NO: 11)

OBA2
GGGGCGAAGCGGGTCCCG
26.2 ± 0.4

(SEQ ID NO: 12)

OBA3
CGGGGCGAAGCGGGTCCCG
1.4 ± 0.1

(SEQ ID NO: 1)

OBA4
GGGGTGAAACG GTCCCG
No Binding

(SEQ ID NO: 13)

OBA5
CCGGGGCGAAGCGGGTCCCGG
1.9 ± 0.1

(SEQ ID NO: 14)

OBA6
GCGGGGCGAAGCGGGTCCCGC
2.4 ± 0.1

(SEQ ID NO: 15)

4. Virtual Saturation Mutation of Sites of Aptamer OBA3

The original aptamer OBA3 of Ochratoxin A is a DNA strand with 19 base, in which the residues G4, G5, C11, G12, T15 and C16 form a binding pocket to bind OTA. OTA binds to OBA3 through the hydrophobic interaction between T15 and the benzene ring of OTA, the hydrogen bonding between the amido group of OTA and the residues G4, G5 and G12, the halogen bonding between the chlorine atom of OTA and G5, and the ternary stacking of base pairs at G5-C11 of OTA with G12-G4-C16. Therefore, the importance of residues G4, G5, C11, G12, T15 and C16 is evident, so these sites are retained. The bases in the top stem area (base Nos. 6-10) and the bottom stem area (base Nos. 1-3, 13-14, and 17-19) were mutated, and the mutant sequence is shown in SEQ ID NO: 16.

There were a total of 13 specific mutation sites, and a total of 413 new sequences were generated. All possible 67,108,864 sequences were comprehensively analyzed, and the structure corresponding to minimum free energy and the minimum free energy were predicted by NUPACK software. as shown in FIG. 11-13.

Next, base mutation was performed on the basis of the original binding conformation of the aptamer to obtain a hypothetical binding conformation of the mutant sequence. Then molecular dynamic simulation was performed by the software Gromacs, to determine whether the hypothetical binding mode is stable and whether it maintains a high binding affinity to the target. The original binding conformation was derived from the PDB library, and the base mutation was performed using X3DNA to obtain the hypothetical binding conformation of the mutant sequence. The simulation system first underwent 5 rounds of energy minimization optimization by steepest descent, and then slowly heated up to 300 k while the solute was constrained, followed by a constraint release process for 60 ps at a step length of 10 fs.

Next, the binding free energy was calculated. The binding ability of the aptamer to the target was a simulated path of the complex, a predicted value of the binding free energy was estimated by using the MMPBA method and the conformational entropy, and the binding free energy was calculated by MMPBA.py in the AmberTools program package.

Virtual screening of the mutation sites was made according to the original docking score of the target OTA and the aptamer OBA3 and the MMGBSA dG Bind (NS). In order to improve the screening efficiency, 32768 sequences with a small free energy barrier were selected and used as an enhanced sequence library. The screening criterion was that the free energy barrier (ΔΔG_GAP) was less than 0.1 kcal/mol. Firstly, molecular dynamic simulation was performed on the 32768 sequences for 150 ps. Then, according to the structural stability, binding free energy, and number of hydrogen bonding between the aptamer and the target, 1092 sequences were selected for 1 ns of molecular dynamics simulation. Next, 132 sequences were selected for 10 ns of molecular dynamic simulation in the third round of screening. Finally, in the fourth round, 30 sequences were subjected to molecular dynamic simulation for a long time of 100 ns, to investigate the overall stability of the complex. Ultimately, it was found that except for the position 9, there was no obvious base enrichment at other positions, and these bases were not enriched at the corresponding positions. Therefore, the site A9 was selected for base mutation, and mutated into T9, G9 and C9 respectively. Then further experiments were carried out.

5. Mutation of Aptamer OBA3

The base A at position 9 from the 5′ end to the 3′ end of the aptamer OBA3 was mutated into the base T, the base G, and the base C to obtain the aptamer A9T, A9G, and A9C, respectively.

6. The Binding Parameters of the Aptamer A9T, A9G, and A9C to the Target OTA, Norfloxacin, Difloxacin Hydrochloride, and Asenapine were Determined by Isothermal Titration Calorimetry (ITC)

The experimental results are shown in Tables 3-5 and FIGS. 6-10 (the data and figures are not presented for ones having weak or no binding). The predicted secondary structures of the aptamers A9T, A9G and A9C and the free energy of their single strands are shown in FIGS. 11 to 13 respectively.

A9G only binds to the target OTA, and has a dissociation constant from the target OTA of 0.14 μM; and the aptamer OBA3 has a dissociation constant from the target OTA of 1.4 μM in a previous literature, so the specificity and affinity are both improved. A9C only binds to the target OTA, and has a dissociation constant from the target OTA of 6.29 μM, so the specificity is improved compared with OTA3. A9T has a dissociation constant from the target OTA of 2.07 μM, and has a dissociation constant from the target Norfloxacin of 0.79 μM.

These indicate that after modification by the molecular modification and design method of the present invention, OBA3 can quickly and effectively improve its binding specificity and affinity to the target OTA.

TABLE 3

Experimental results of aptamer A9C

binding to different targets by ITC

Difloxacin

Target
OTA
Norfloxacin
hydrochloride

Aptamer
A9C
A9C
A9C

Instrument
VP-ITC
VP-ITC
VP-ITC

N (sites)
0.91 ± 0.069

K (M⁻¹)
1.59E5 ± 4.35E4

Kd (μmol/L)
6.29

Remark

No Binding
No Binding

TABLE 4

Experimental results of aptamer A9G

binding to different targets by ITC

Target
OTA
Norfloxacin
Difloxacin

Aptamer
A9G
A9G
A9G

Instrument
VP-ITC
VP-ITC
VP-ITC

N (sites)
1.62 ± 0.055

K (M−1)
6.93E6 ± 7.50E6

Kd (μmol/L)
0.14

Remark

No Binding
No Binding

TABLE 5

Experimental results of aptamer A9T

binding to different targets by ITC

Target
OTA
Norfloxacin
Difloxacin

Aptamer
A9T
A9T
A9T

Instrument
VP-ITC
VP-ITC
VP-ITC

N (sites)
1.13 ± 0.020
1.14 ± 0.018
0.888 ± 0.019

K (M−1)
4.83E5 ± 7.73E4
1.26E6 ± 3.11E5
1.02E6 ± 5.25E5

Kd (μmol/L)
2.07
0.79
0.98

Example 2: Molecular Modification Method to Improve the Specificity and Affinity of Aflatoxin B1 Aptamer

1. Screening of Targets of Aflatoxin B1 Aptamer

Different aptamers of different mycotoxin targets were sorted and compared, and the aptamer (having a sequence as shown in SEQ ID NO: 5) for Aflatoxin B1 (referred to as AFB1) was used as the object for modification. All compounds were prepared by the LigPrep module, and the compounds were retrieved from the compound information database (including Protein Data Bank (PDB), and ZINC database, etc.). The docking grid was centered on the Aflatoxin B1 aptamer (referred to as AFB1 aptamer hereinafter), and all compounds were docked by Glide SP1. After combining with the results of high-throughput virtual screening, the compounds with the best docking scores were retained for Prime MM-GBSA calculation. In the calculation, the force field energy of the molecules involved in the binding process in an implicit solvent was calculated. In the presence of a CHARMM force field and a CGenFF force field in combination, all the bases in the docking compound 6 Å were relaxed by the VSGB2.0 model. Finally, compounds with the similar “MMGBSA DG Bind (NS)” (the binding free energy calculated by Prime MM-GBSA) to Aflatoxin B1 were selected for unconstrained molecular dynamic simulation. Virtual screening was made according to the docking score of the original target AFB1 and the AFB1 aptamer and the MMGBSA dG Bind (NS).

2. The Preliminary Binding Affinity of the Compounds Obtained by Computational Screening to the Aptamer were Respectively Determined by Fluorescence Labeling.

2.1. Binding affinity test of AFB1 aptamer to AFB1 (control): Using a buffer (pH 7.4) as a diluent, the aptamer (25 μL, 1 μmol/L) and 50 μL of different concentrations (0 μM/L, 2 μM/L, and 100 μM/L) of AFB1 solution were mixed in wells of a microplate. Each solution was incubated at 25° C. for 10 min. Then, a complementary strand CDNA (25 μL, 1 μmol/L) of the aptamer and 20 μL 5×PG were added to the solution. After incubation for 5 min, the fluorescence intensity was scanned on a microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 525 nm.

2.2. Binding affinity test of AFB1 to target Thiamine: Using a buffer (pH 7.4) as a diluent, the aptamer AFB1 (25 μL, 1 μmol/L) and 50 μL of different concentrations (0 μM/L, 2 μM/L, and 100 μM/L) of Thiamine solution were mixed in wells of a microplate. Each solution was incubated at 25° C. for 10 min. Then, the complementary strand CDNA (25 μL, 1 μmol/L, having a sequence as shown in SEQ ID NO: 9) of the aptamer and 20 μL 5×PG were added to the solution. After incubation for 5 min, the fluorescence intensity was scanned on a microplate reader at an excitation wavelength of 480 nm and an emission wavelength of 525 nm.