The homology, similarity, or identity between two polynucleotide or polypeptide sequences may be determined using any computer algorithm known in the art, e.g., the “FASTA” program, using default parameters introduced by Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444. Alternatively, the homology, similarity, or identity may be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453) as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (version 5.0.0 or later) (including the GCG program package (Devereux, J. et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, S. F. et al., J MOLEC BIOL 215:403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994; and CARILLO et al. (1988) SIAM J Applied Math 48:1073). For example, the homology, similarity, or identity may be determined using BLAST, from the National Center for Biotechnology Information database, or ClustalW.

The homology, similarity, or identity between polynucleotides or polypeptides may be determined by comparing sequence information using the GAP computer program as introduced by Needleman et al., (1970), J Mol Biol. 48:443 as disclosed by Smith and Waterman, Adv. Appl. Math (1981) 2:482. Briefly, the GAP program defines similarity as the number of aligned symbols (i.e., nucleotides or amino acids) which are similar, divided by the total number of symbols in a shorter of two sequences. Default parameters for the GAP program may include: (1) a binary comparison matrix (containing a value of 1 for identities and 0 for non identifies) and the weighted comparison matrix of Gribskov, et al. (1986), Nucl. Acids Res. 14:6745 as described by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence and Structure, National Biomedical Research Foundation, pp. 353-358 (1979) (or EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap open penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps.

Another aspect of the present disclosure provides a polynucleotide encoding the L-threonine dehydratase variant of the present disclosure.

The amino acid sequence of SEQ ID NO: 1, L-threonine dehydratase, and variant thereof are as described above.

As used herein, the term “polynucleotide” refers to a DNA or RNA strand having a certain minimum length as a polymer of nucleotides in which nucleotide monomers are linked to each other in the form of a long chain by covalent bonds. In the present disclosure, the polynucleotide may refer to a polynucleotide fragment encoding the L-threonine dehydratase variant of the present disclosure.

The polynucleotide may include any nucleotide sequences encoding the L-threonine dehydratase variant of the present disclosure without limitation. In the present disclosure, a gene encoding the amino acid sequence of L-threonine dehydratase is ilvA gene, and the gene may be derived specifically from Corynebacterium glutamicum, without being limited thereto.

Specifically, the polynucleotide encoding the L-threonine dehydratase variant of the present disclosure may include a base sequence encoding the L-threonine dehydratase variant in which the amino acid corresponding to the 381^stposition of the amino acid sequence of SEQ ID NO: 1 is substituted with a different amino acid.

The polynucleotide may include various modifications made in a coding region provided not to change the amino acid sequence of the polypeptide expressed from the coding region due to codon degeneracy or in consideration of a codon preferred by a living organism in which the polypeptide is to be expressed. Any nucleotide sequence encoding the L-threonine dehydratase variant in which the amino acids corresponding to the 381^stposition of SEQ ID NO: 1 is substituted with a different amino acid may be included therein without limitation.

In addition, the polynucleotide may include any probe prepared from any known gene sequences, e.g., a nucleotide sequence hybridized with a sequence totally or partially complementary to the above-described nucleotide sequence under stringent conditions, without limitation. The term “stringent conditions” refers to conditions allowing specific hybridization between polynucleotides. Such conditions are disclosed in detail in known documents (For example, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2^ndEdition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F. M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, the stringent conditions may include performing hybridization between polynucleotides having a high homology or identity, e.g., a homology or identity of 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, without performing hybridization between polynucleotides having a homology or identity lower than the above homologies or identities, or washing once, specifically twice or three times, under conventional washing conditions for Southern hybridization at a salt concentration and temperature of 60° C., 1×SSC, and 0.1% SDS, specifically 60° C., 0.1×SSC, 0.1% SDS, and more specifically 68° C., 0.1×SSC, and 0.1% SDS.

Hybridization requires that two nucleic acids have complementary sequences, although bases may mismatch according to the degree of stringency of hybridization. The term “complementary” is used to describe the relationship between bases of nucleotides capable of hybridizing with each other. For example, with respect to DNA, adenosine is complementary to thymine and cytosine is complementary to guanine. Thus, the present disclosure may include not only a substantially similar nucleic acid sequence but also a nucleic acid fragment which is isolated but complementary to the entire sequence.

Specifically, the polynucleotides having homology or identity with the polynucleotide of the present disclosure may be detected using hybridization conditions including a hybridization process at a T_mvalue of 55° C. and the above-described conditions. Also, the T_mvalue may be, but is not limited to, 60° C., 63° C., or 65° C., and may be appropriately adjusted by those skilled in the art according to the intended purposes.

An appropriate degree of stringency for hybridization of the polynucleotides may depend on lengths and a degree of complementarity of the polynucleotides, and parameters thereof are well known in the art (e.g., J. Sambrook et al., supra).

In addition, the polynucleotide encoding the L-threonine dehydratase variant of the present disclosure may include a base sequence encoding a L-threonine dehydratase variant in which i) the amino acid corresponding to the 381^stposition is substituted with a different amino acid, and/or ii) the amino acid corresponding to the 383^rdposition is substituted with a different amino acid in the amino acid sequence of SEQ ID NO: 1. The polynucleotide may include any nucleotide sequence encoding a L-threonine dehydratase variant in which at least one amino acid selected from the amino acids corresponding to the 381^stposition and/or the 383^rdposition of the amino acid sequence of SEQ ID NO: 1 is substituted with a different amino acid.

Another aspect of the present disclosure provides a vector including the polynucleotide encoding the L-threonine dehydratase variant of the present disclosure.

The amino acid sequence of SEQ ID NO: 1, L-threonine dehydratase, variant thereof, and polynucleotide are as described above.

As used herein, the term “vector” refers to a DNA construct containing a base sequence of a polynucleotide encoding a target protein and operably linked to a suitable regulatory sequence so as to be able to express the target protein in a suitable host cell. The regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating the transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence for regulating termination of transcription and translation. When a suitable host cell is transformed with the vector, the vector may replicate or function independently from the host genome, or may integrate into the genome thereof.

The vector used in the present disclosure is not particularly limited, and any vector known in the art may be used. Examples of conventional vectors may include a natural or recombinant plasmid, cosmid, virus, and bacteriophage. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as a phage vector or a cosmid vector. As a plasmid vector, pBR type, pUC type, pBluescriptII type, pGEM type, pTZ type, pCL type, and pET type may be used. Specifically, pDZ, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, and pCC1BAC vectors may be used.

For example, a polynucleotide encoding a target polypeptide may be inserted into the chromosome by using a vector for chromosomal insertion into cells. The insertion of the polynucleotide into the chromosome may be performed using any method known in the art, for example, homologous recombination, without being limited thereto. The polynucleotide may further include a selection marker to confirm chromosomal insertion. The selection marker is used to select cells that are transformed with the vector, that is, to confirm insertion of desired nucleic acid molecules, and examples of the selection marker may include markers providing selectable phenotypes, such as drug resistance, nutrient requirement, resistance to cytotoxic agents, or surface expression of a polypeptide. Only cells expressing the selection marker are able to survive or to show different phenotypes under the environment treated with a selective agent, and thus the transformed cells may be selected.

Another aspect of the present disclosure provides an L-isoleucine-producing microorganism including at least one of: the L-threonine dehydratase variant of the present disclosure; a polynucleotide encoding the variant; and a vector including the polynucleotide.

The amino acid sequence of SEQ ID NO: 1, L-threonine dehydratase, variant thereof, polynucleotide, and vector are as described above.

As used herein, the term “L-isoleucine-producing microorganism” includes all of wild-type microorganisms and microorganisms in which natural or artificial genetic modification occurs, and may be a microorganism including genetic modification in order to produce a target protein or product in which a particular mechanism is weakened or enhanced via introduction of a foreign gene or enhancement or inactivation of an endogenous gene.

The L-isoleucine-producing microorganism of the present disclosure may be a microorganism having the ability to produce a target protein or a target product involved in production of the target protein by including at least one of the polypeptide; a polynucleotide encoding the same; and a vector including the polynucleotide, without being limited thereto. The microorganism may be a microorganism naturally having the ability to produce a target protein or a target product or a microorganism prepared by providing the ability to produce the target protein or the target product to a parent strain unable to produce the target protein or the target product, without being limited thereto. In view of the objects of the present disclosure, the target protein may be a L-threonine dehydratase variant, and the target product may be L-isoleucine.

The L-isoleucine-producing microorganism may be a microorganism genetically modified via at least one of the polypeptide of the present disclosure, a polynucleotide encoding the same, and a vector including the polynucleotide; a microorganism modified to express the polypeptide or a polynucleotide encoding the same; a recombinant microorganism expressing the polypeptide or a polynucleotide encoding the same; or a recombinant microorganism having the activity of the polypeptide, without being limited thereto. In view of the objects of the present disclosure, the L-isoleucine-producing microorganism may refer to a microorganism having enhanced L-isoleucine producing capability by way of introduction of the L-threonine dehydratase variant into a microorganism naturally having weak L-isoleucine producing capability. Specifically, the microorganism may be a microorganism expressing a L-threonine dehydratase variant in which an amino acid corresponding to the 381^stposition of the amino acid sequence of SEQ ID NO: 1 is substituted with a different amino acid, wherein the L-threonine dehydratase variant may be one in which the amino acid corresponding to the 381^stposition of the amino acid sequence of SEQ ID NO: 1 is substituted with at least one amino acid selected from the group consisting of alanine, serine, proline, glutamine, valine, isoleucine, glycine, and methionine, without being limited thereto.

In addition, in the L-isoleucine-producing microorganism, the activity of the L-threonine dehydratase increases compared to wild-type or non-modified microorganisms, and thus the ability to produce 2-ketobutyrate, as a precursor of L-isoleucine, is enhanced, resulting in enhancement of L-isoleucine producing capability. Wild-type or non-modified microorganisms cannot produce or may produce trace amounts of L-isoleucine. In contrast, it is significant that production of L-isoleucine may increase due to an increase in the production of the precursor of L-isoleucine via introduction of the L-threonine dehydratase variant of the present disclosure.

As used herein, the term “non-modified microorganism” does not exclude strains including mutations naturally occurring in microorganisms, and may refer to a wild-type strain or a natural-type strain, or a strain before being transformed due to a natural or artificial factor. The term “non-modified microorganism” may be used interchangeably with “pre-modified strain”, “pre-modified microorganism”, “non-mutated strain”, “non-modified strain”, “non-mutated microorganism”, or “reference microorganism”.

In addition, the L-isoleucine-producing microorganism of the present disclosure may express not only the L-threonine dehydratase variant in which the amino acid corresponding to the 381^stposition of the amino acid sequence of SEQ ID NO: 1 is substituted with a different amino acid, but also the L-threonine dehydratase variant in which the amino acid corresponding to the 383^rdposition of the amino acid sequence of SEQ ID NO: 1 is further substituted with a different amino acid. The L-isoleucine-producing microorganism of the present disclosure may specifically be a microorganism expressing the L-threonine dehydratase variant in which i) the amino acid corresponding to the 381^stposition is substituted with a different amino acid, and/or ii) the amino acid corresponding to the 383^rdposition is substituted with a different amino acid, in the amino acid sequence of SEQ ID NO: 1, more specifically a microorganism expressing the L-threonine dehydratase variant in which i) the amino acid corresponding to the 381^stposition is substituted with at least one amino acid selected from the group consisting of alanine, serine, proline, glutamine, valine, isoleucine, glycine, and methionine, and/or ii) the amino acid corresponding to the 383^rdposition is substituted with alanine, in the amino acid sequence of SEQ ID NO: 1, without being limited thereto.

As used herein, a protein “to be expressed/being expressed” means a state in which a target protein is introduced into or expressed in a microorganism. When the target protein is a protein present in the microorganism, the activity of the protein is enhanced compared to the intrinsic activity or that of the protein before modification. In view of the objects of the present disclosure, the “target protein” may be the above-described L-threonine dehydratase variant. Specifically, the term “introduction of a protein” refers to providing activity of a particular protein to a microorganism which does not possess the protein or enhancing the activity of the protein compared to the intrinsic activity of the protein or the activity before modification. For example, the introduction of a protein may refer to introduction of a polynucleotide encoding a particular protein into a chromosome or introduction of a vector including the polynucleotide encoding the particular protein into a microorganism to thereby express the activity of the protein.

As used herein, the “enhancement” of the activity of a polypeptide may mean that the activity of the polypeptide is increased when compared with the intrinsic activity. The term “enhancement” may be used interchangeably with activation, up-regulation, overexpression, and increase. In this regard, the activation, up-regulation, overexpression, and increase may include of all exhibition of an activity that was not originally possessed or exhibition of improved activity compared to intrinsic activity or activity before modification. The “intrinsic activity” refers to activity of a particular polypeptide possessed by a parent strain or a non-modified microorganism before transformation when the transformation is caused by modification by a natural or artificial factor. This term may be used interchangeably with “activity before modification”. The “enhancement”, “up-regulation”, “overexpression”, or “increase” of the activity of the polypeptide compared to intrinsic activity means that activity and/or concentration (expression level) of a particular polypeptide is increased compared to those of a parent strain or non-modified microorganism before transformation.

The enhancement may be achieved via introduction of a foreign polypeptide or enhancement of intrinsic activity and/or concentration (expression level) of the polypeptide. The enhancement of the activity of the polypeptide may be confirmed based on the degree of activity of the polypeptide or an increase in an amount of a product released from the polypeptide.

Enhancement of the activity of the polypeptide may be achieved by applying any method well known in the art without limitation, as long as the activity of the target polypeptide is enhanced compared to that of the microorganism before modification. Specifically, any genetic engineering and/or protein engineering methods well known in the art as common methods of the molecular biology may be used, without being limited thereto (For example, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16; Sambrook et al. Molecular Cloning 2012; etc.).

Specifically, the enhancement of the polypeptide of the present disclosure may be achieved by:

- (1) increasing the copy number of a polynucleotide encoding the polypeptide;
- (2) replacing a gene expression regulatory region on the chromosome encoding the polypeptide with a sequence with stronger activity;
- (3) modifying a base sequence encoding an initiation codon or a 5′-UTR region of a gene transcript encoding the polypeptide;
- (4) modifying an amino acid sequence of the polypeptide to enhance the activity of the polypeptide;
- (5) modifying a nucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide (e.g., modifying a nucleotide sequence of a gene of the polypeptide to encode a polypeptide modified to have enhanced activity);
- (6) introducing a foreign polypeptide having the activity of the polypeptide or a foreign polynucleotide encoding the same;
- (7) optimizing a codon of a polynucleotide encoding the polypeptide;
- (8) modifying or chemically modifying an exposed region selected by analyzing a three-dimensional structure of the polypeptide; or
- (9) any combination of two or more selected from (1) to (8) above, without being limited thereto.

More specifically, the increase in the copy number of the polynucleotide encoding the polypeptide described in (1) above is achieved by introduction of a vector, which replicates and functions irrespective of a host cell and is operably linked to the polynucleotide encoding the polypeptide, into a host cell. Alternatively, the increase in the copy number may be achieved by introducing one copy or two or more copies of the polynucleotide encoding the polypeptide into the chromosomes of the host cell. Introduction into the chromosome may be performed using a vector capable of inserting the polynucleotide into the chromosome in the host cell, without being limited thereto. The vector is as described above.

The replacement of a gene expression regulatory region (or expression regulatory sequence) on the chromosome encoding the polypeptide with a sequence with stronger activity described in (2) above may be achieved by inducing mutation in the sequence by deletion, insertion, non-conservative or conservative substitution, or any combination thereof or by replacing the sequence with a sequence with stronger activity, to further enhance the activity of the expression regulatory region. The expression regulatory region may include a promoter, an operator sequence, a ribosome binding site-encoding sequence, and a sequence for regulating termination of transcription and translation, without being limited thereto. For example, the replacement may be replacement of an intrinsic promoter with a stronger promoter, without being limited thereto.

Examples of the stronger promoter may include CJ1 to CJ7 promoters (U.S. Pat. No. 7,662,943 B2), a lac promoter, a trp promoter, a trc promoter, a tac promoter, a Lambda phage PR promoter, a PL promoter, a tet promoter, a gapA promoter, an SPL7 promoter, an SPL13 promoter (sm3, U.S. Pat. No. 10,584,338 B2), an O2 promoter (U.S. Pat. No. 10,273,491 B2), a tkt promoter, and a yccA promoter, without being limited thereto.

The modification of a base sequence encoding an initiation codon or a 5′-UTR region of a gene transcript encoding the polypeptide described in (3) above may be achieved by, for example, substituting the base sequence encoding the intrinsic initiation codon with another base sequence encoding an initiation codon with a higher expression level of the polypeptide, without being limited thereto.

The modification of the amino acid sequence or the nucleotide sequence described in (4) and (5) above may be conducted by inducing mutation in the amino acid sequence of the polypeptide or in the nucleotide sequence encoding the polypeptide by deletion, insertion, non-conservative or conservative substitution, or any combination thereof to further enhance the activity of the polypeptide, or by replacing the amino acid sequence or the nucleotide sequence with an amino acid sequence or a nucleotide sequence modified to have stronger activity, without being limited thereto. Specifically, the replacement may be performed by inserting the polynucleotide into the chromosome via homologous recombination, without being limited thereto. A vector used herein may further include a selection marker to identify insertion into the chromosome. The selection marker is as described above.

The introduction of a foreign polynucleotide having the activity of the polypeptide described in (6) above may be achieved by introducing a foreign polynucleotide encoding a polypeptide having activity identical/similar to that of the polypeptide into a host cell. The origin or sequence of the foreign polynucleotide is not particularly limited as long as the foreign polynucleotide exhibits activity identical/similar to that of the polypeptide. A method used in the introduction may be appropriately selected by those of ordinary skill in the art. As the introduced polynucleotide is expressed in the host cell, the polypeptide is produced, and the activity thereof may be enhanced.

The codon optimization of the polynucleotide encoding the polypeptide described in (7) above may be achieved by optimizing a codon to increase transcription or translation of an intrinsic polynucleotide in a host cell or by optimizing a codon to allow optimized transcription or translation of a foreign polynucleotide in a host cell.

The modification or chemical modification of an exposed region selected by analyzing a three-dimensional structure of the polypeptide described in (8) above may be achieved by determining a template protein candidate according to similarity between sequences based on comparison between information on a sequence of the polypeptide to be analyzed and a database that stores information on sequences of existing proteins, identifying the structure based thereon, selecting an exposed region to be modified or chemically modified, and modifying or chemically modifying the exposed region.

The enhancement of the activity of the polypeptide as described above may be an increase in the activity or concentration (expression level) of the polypeptide compared with the activity or concentration of the polypeptide expressed in the wild-type or non-modified microorganism strains or an increase in an amount of a product obtained from the polypeptide, without being limited thereto.

In the microorganism of the present disclosure, modification of the polynucleotide in whole or in part may be induced by (a) homologous recombination using a vector for chromosomal insertion into the microorganism or genome editing using genetic scissors (engineered nuclease, e.g., CRISPR-Cas9) and/or (b) treatment with light such as UV light and radiation and/or chemicals, without being limited thereto. Methods for modification of the gene in whole or in part may include DNA recombination. For example, deletion of the gene in whole or in part may occur by inducing homologous recombination by inserting a nucleotide sequence or vector including a homologous nucleotide sequence with a target gene. The inserted nucleotide sequence or vector may include a dominant selection marker, without being limited thereto.

The enhancement of the activity of the polypeptide or protein as described above may be an increase in the activity or concentration of the polypeptide or protein compared with the activity or concentration of the polypeptide or protein expressed in the wild-type or non-modified microorganism strains or an increase in an amount of a product obtained from the polypeptide or protein, without being limited thereto.

The microorganism including the L-threonine dehydratase variant may be a recombinant microorganism, and recombination may be performed by genetic modification such as transformation. Specifically, the microorganism of the present disclosure may be a recombinant microorganism transformed with a vector including a polynucleotide encoding the L-threonine dehydratase variant, without being limited thereto.

As used herein, the term “transformation” refers to a process of introducing the vector including the polynucleotide encoding the target protein into a host cell in such a way that the protein encoded by the polynucleotide is expressed in the host cell. The transformed polynucleotide may be either in a form inserted into the chromosome of the host cell or in a form located outside the chromosome as long as the protein is expressed in the host cell. In addition, the polynucleotide includes DNA and RNA encoding the target protein. The polynucleotide may be introduced into the host cell in any form as long as the polynucleotide is introduced into the host cell and the protein is expressed therein. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a gene construct including all of the essential elements required for self-replication. The expression cassette may generally include a promoter operably linked to the polynucleotide, a transcription termination signal, a ribosome binding site, and a translation termination signal. The expression cassette may be in the form of a self-replicable expression vector. Also, the polynucleotide may be introduced into the host cell in its original form and operably linked to a sequence required for the expression in the host cell, without being limited thereto.

In addition, as used herein, the term “operably linked” means a functional linkage between a nucleotide sequence encoding the polypeptide of the present disclosure and a promoter sequence which initiates and mediates transcription of the nucleotide sequence.

Methods for the transformation according to the present disclosure include any methods enabling introduction of a nucleic acid into the host cell, and may be performed by suitable standard techniques well known in the art selected according to the host cell. For example, electroporation, calcium phosphate (CaPO₄) precipitation, calcium chloride (CaCl₂) precipitation, microinjection, a polyethylene glycol (PEG) method, a DEAE-dextran method, a cationic liposome method, and a lithium acetate-DMSO method may be used, but the present disclosure is not limited thereto.

Types of the L-isoleucine-producing microorganism are not particularly limited as long as the microorganism produces L-isoleucine, and examples of the L-isoleucine-producing microorganism may include microorganisms belonging to the genus Corynebacterium, the genus Escherichia, the genus Enterobacter, the genus Erwinia, the genus Serratia, the genus Providencia, and the genus Brevibacterium, specifically microorganisms belonging the genus Corynebacterium.

As used herein, the “microorganism belonging to the genus Corynebacterium” may include all microorganisms belonging to the genus Corynebacterium. Specifically, the microorganism may be Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens, more specifically Corynebacterium glutamicum.

In the present disclosure, a parent strain of the microorganism may be a microorganism in which a biosynthesis pathway of L-isoleucine is further enhanced to increase production of L-isoleucine, without being limited thereto.

Specifically, the microorganism may be a microorganism in which a genetic mutation (R407H) is further introduced into hom gene encoding homoserine dehydrogenase (U.S. Patent Application Publication No. US 2020-0340022 A1) or a microorganism in which genetic mutation (L377K) is further introduced into lysC gene encoding aspartokinase (U.S. Pat. No. 10,662,450 B2) to enhance the biosynthesis pathway of L-isoleucine, for example, to relieve feedback inhibition of threonine, which is a precursor of isoleucine. However, the present disclosure is not limited thereto, and the production of L-isoleucine may be increased using any method of regulating gene expression that is well known in the art.

As used herein, the term “enhancement/increase” is a concept including an increase in the activity compared to the intrinsic activity.

The enhancement or increase of gene activity may be achieved by application of various methods well known in the art. Examples of the methods may include at least one selected from the group consisting of: a method of increasing the copy number of a gene; a method of introducing mutation into an expression regulatory sequence of the gene; a method of replacing the expression regulatory sequence of the gene with a sequence having stronger activity; a method of additionally introducing mutation into the gene in order to enhance the activity of the gene; a method of introducing a foreign gene into a microorganism; and any combination thereof, without being limited thereto.

As another example for increasing production of L-isoleucine, a parent strain of the microorganism of the present disclosure may be a microorganism in which a gene weakening the biosynthesis pathway of L-isoleucine is further inactivated to increase production of L-isoleucine, without being limited thereto.

As used herein, the term “weakening” of the polypeptide is a concept including both reduction and elimination of the activity compared to intrinsic activity. The term weakening may be used interchangeably with inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.

The weakening may include: a case in which the activity of the polypeptide is reduced or eliminated compared to intrinsic activity processed by the microorganism due to mutation of a polynucleotide encoding the polypeptide or the like; a case in which the activity and/or concentration (expression level) of the polypeptide in cells are lower than those of the wild-type strain due to suppressed gene expression of a polynucleotide encoding the same or suppressed translation thereof into the polypeptide; a case in which the polynucleotide is not expressed at all; and/or a case in which no activity of the polypeptide is obtained even though the polynucleotide is expressed. The term “intrinsic activity” refers to activity of a polypeptide originally possessed by a parent strain, wild-type, or non-modified microorganism before transformation when the microorganism is transformed by genetic modification caused by a natural or artificial factor. The intrinsic activity may also be used interchangeably with “activity before modification”. The “inactivation, deficiency, down-regulation, decrease, reduce, and attenuation” of the activity of the polypeptide compared to intrinsic activity means lowering of the activity compared to the activity of the polypeptide originally possessed by a parent strain or non-modified microorganism before transformation.

The weakening of the activity of the polypeptide may be performed by, but is not limited to, any method well known in the art, and may be achieved by applying various methods well known in the art (for example, Nakashima N. et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014; 15(2):2773-2793; Sambrook et al. Molecular Cloning 2012; etc.).

Specifically, the weakening of the polypeptide of the present disclosure may be achieved by:

- (1) deleting a gene encoding the polypeptide in whole or in part;
- (2) modifying a gene expression regulatory region (or expression regulatory sequence) to reduce expression of the gene encoding the polypeptide;
- (3) modifying an amino acid sequence constituting the polypeptide to eliminate or weaken the activity of the polypeptide (e.g., deletion/substitution/addition of at least one amino acid in the amino acid sequence);
- (4) modifying a sequence of a gene encoding to the polypeptide to eliminate or weaken the activity of the polypeptide (e.g., deletion/substitution/addition of at least one base of a nucleic acid in a base sequence of the gene of the polypeptide to encode a polypeptide modified to eliminate or weaken the activity of the polypeptide;
- (5) modifying a base sequence encoding an initiation codon or a 5′-UTR region of a gene transcript encoding the polypeptide;
- (6) introducing an antisense oligonucleotide (e.g., introduction of antisense RNA) complementarily binding to a gene transcript encoding the polypeptide;
- (7) adding a sequence complementary to a Shine-Dalgarno sequence of a gene encoding the polypeptide upstream of the Shine-Dalgarno sequence to form a secondary structure making binding of a ribosome impossible;
- (8) adding a promoter for reverse transcription to the 3′ terminus of the open reading frame (ORF) of a sequence of a gene encoding the polypeptide (reverse transcription engineering, RTE); or
- (9) any combination of two or more selected from (1) to (8) above, without being limited thereto.

For example, the deletion of a gene encoding the polypeptide in whole or in part described in (1) above may be achieved by deleting the entire polynucleotide encoding an intrinsic target polypeptide in the chromosome or by replacing the polynucleotide with a polynucleotide in which one or several nucleotides are deleted or with a marker gene.

Also, the modification of a gene expression regulatory region (or expression regulatory sequence) described in (2) above may be achieved by mutation in the expression regulatory region (or expression regulatory sequence) by deletion, insertion, non-conservative or conservative substitution, or any combination thereof or replacement with a sequence having weaker activity. The expression regulatory region includes a promoter, an operator sequence, a ribosome binding site-encoding sequence, and a sequence for regulating termination of transcription and translation, without being limited thereto.

In addition, the modification of the base sequence encoding an initiation codon or a 5′-UTR region of a gene transcript encoding the polypeptide described in (5) above may be achieved by, for example, substituting the base sequence encoding the intrinsic initiation codon with another base sequence encoding an initiation codon with a lower expression level of the polypeptide, without being limited thereto.

In addition, the modification of the amino acid sequence or the nucleotide sequence described in (3) and (4) above may be conducted by inducing mutation in the amino acid sequence of the polypeptide or in the nucleotide sequence encoding the polypeptide by deletion, insertion, non-conservative or conservative substitution, or any combination thereof or by replacing the amino acid sequence or the nucleotide sequence with an amino acid sequence or a nucleotide sequence modified to have weaker activity or not to have the activity to further weaken the activity of the polypeptide, without being limited thereto. For example, expression of the gene may be suppressed or weakened by forming a termination codon by introducing a mutation into the nucleotide sequence, without being limited thereto.

The introduction of an antisense oligonucleotide (e.g., antisense RNA) complementarily binding to a gene transcript encoding the polypeptide described in (6) above may be achieved using a method disclosed in a document (Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews—Trends in Genetics, Vol. 1(1) 1986).

The addition of a sequence complementary to a Shine-Dalgarno sequence of a gene encoding the polypeptide upstream of the Shine-Dalgarno sequence to form a secondary structure making binding of a ribosome impossible described in (7) above may make mRNA translation impossible or reduce the speed.

The addition of a promoter for reverse transcription to the 3′ terminus of the open reading frame (ORF) of a sequence of a gene encoding the polypeptide (reverse transcription engineering, RTE) described in (8) above may weaken the activity by forming an antisense nucleotide complementary to the gene transcript encoding the polypeptide.

In the present disclosure, the parent strain of the microorganism may be the wild-type Corynebacterium glutamicum ATCC13032, a microorganism prepared by additionally introducing horn gene (R407H) encoding homoserine dehydrogenase (U.S. Patent Application Publication No. US 2020-0340022 A1) into the ATCC1303 for relieving feedback inhibition of threonine, which is a precursor of isoleucine, a microorganism prepared by additionally introducing lysC(L377K) encoding aspartokinase (U.S. Pat. No. 10,662,450 B2) into the ATCC130, L-isoleucine-producing KCJI-38 strain (KCCM11248P, Korean Patent No. 10-1335789) treated with N-methyl-N′-nitro-N-nitrosoguanidine (NTG), or an ATCC 13032 hom(R407H)/pECCG117-ilvA(F383A) strain prepared by simultaneously introducing hom(R407H) and ilvA(F383A) into the ATCC13032, without being limited thereto.

Another aspect of the present disclosure provides a method of producing L-isoleucine, the method including culturing a microorganism including at least one of: the L-threonine dehydratase variant of the present disclosure; a polynucleotide encoding the variant; and a vector including the polynucleotide, in a culture medium.

The amino acid sequence of SEQ ID NO: 1, L-threonine dehydratase, variant thereof, polynucleotide, vector, and microorganism are as described above.

The microorganism may belong to the genus Corynebacterium, and specifically, it may be Corynebacterium glutamicum, without being limited thereto. These are as described above.

As used herein, the term “culturing” refers to growing the host cell in an appropriately adjusted environment. A culturing process of the present disclosure may be performed using appropriate culture medium and culture conditions well known in the art. Specifically, the culturing process may be performed using a batch culture method, a continuous culture method, and a fed-batch culture method, without being limited thereto.

As used herein, the term “culture medium” refers to a material in which nutrients required for culturing the microorganism are mixed as main elements and supplies nutrients and growth factors as well as water, which are essential for survival and growth. Specifically, although culture media and other culturing conditions for the microorganism of the present disclosure are not particularly limited as long as the media are commonly used in culturing microorganisms, the microorganism of the present disclosure may be cultured in an ordinary medium containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and/or vitamins under aerobic conditions while adjusting temperature, pH, and the like.

Specifically, the culture medium for strains belonging to the genus Corynebacterium is disclosed in a document (“Manual of Methods for General Bacteriology” by the American Society for Bacteriology (Washington D.C., USA, 1981)).

In the present disclosure, as the carbon sources, carbohydrates such as glucose, fructose, sucrose, and maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, and citric acid; and amino acids such as glutamic acid, methionine, and lysine may be used, without being limited thereto. In addition, natural organic nutrients such as starch hydrolysates, molasses, blackstrap molasses, rice bran, cassava, sugar cane bagasse, and corn steep liquor may be used, and specifically, carbohydrates such as glucose and sterile pretreated molasses (i.e., molasses converted to reduced sugars) may be used, and suitable amounts of any other carbon sources may also be used without limitation. These carbon sources may be used alone or in a combination of at least two thereof.

As the nitrogen sources, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, and ammonium nitrate; and organic nitrogen sources such as amino acids, e.g., glutamic acid, methionine, and glutamine, peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolysate, fish or degradation products thereof, and defatted soybean cake or degradation products thereof may be used. These nitrogen sources may be used alone or in a combination of at least two thereof, without being limited thereto.

As the phosphorus sources, monopotassium phosphate, dipotassium phosphate, or sodium-containing salts corresponding thereto may be used. As inorganic compounds, sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, and the like may be used. Also, amino acids, vitamins, and/or appropriate precursors may be further included. The culture medium and precursors may be added to the culture medium in a batch or continuous process, without being limited thereto.

In the present disclosure, during the culturing process of the microorganism, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, and sulfuric acid may be properly added to the cultures in order to adjust the pH of the culture medium. Also, a defoaming agent such as a fatty acid polyglycol ester may be added during culturing in order to inhibit formation of foams. In addition, oxygen or oxygen-containing gas may be injected into the culture medium to maintain the culture medium in an aerobic condition, and nitrogen, hydrogen, or carbon dioxide gases may be injected into the cultures to maintain the culture in anaerobic and micro-aerobic conditions without injecting any other gases therefor.

The temperature of the culture medium may be maintained at 25° C. to 50° C., more specifically at 30° C. to 37° C., without being limited thereto. The culturing may be continued until a desired amount of a product is obtained, specifically for 10 hours to 100 hours, without being limited thereto.

The L-isoleucine produced by way of the culturing may be released into the culture medium or remain in the cells.

The method of producing L-isoleucine according to the present disclosure may further include recovering L-isoleucine from the culture medium or the microorganism.

L-Isoleucine may be recovered by collecting L-isoleucine from the culture solution using any known method selected according to the culturing method. For example, L-isoleucine may be recovered by centrifugation, filtration, anion-exchange chromatography, treatment with crystallized protein precipitating agent (salt-out method), extraction, ultrasonic destruction, ultrafiltration, dialysis, various chromatography methods such as molecular-sieve chromatography (gel filtration), adsorption chromatography, ion-exchange chromatography, and affinity chromatography, HPLC and any combination thereof, and L-isoleucine may be recovered from the culture medium or the microorganism using any suitable method well known in the art.

The method may further include a purification process. The purification process may be performed using any appropriate method well known in the art to purify the recovered L-isoleucine. Thus, the recovered L-isoleucine may be in a purified form or a fermentation broth of the microorganism including a target product (Introduction to Biotechnology and Genetic Engineering, A. J. Nair, 2008).

Another aspect of the present disclosure provides a composition for producing L-isoleucine including a microorganism including at least one of: the L-threonine dehydratase variant; a polynucleotide encoding the variant; and a vector including the polynucleotide, or cultures of the microorganism.

The amino acid sequence of SEQ ID NO: 1, L-threonine dehydratase, variant thereof, polynucleotide, vector, and microorganism are as described above.

The microorganism may belong to the genus Corynebacterium, and specifically, it may be Corynebacterium glutamicum, without being limited thereto. These are as described above.

The composition for producing L-isoleucine may refer to a composition capable of producing L-isoleucine by way of the L-threonine dehydratase variant of the present disclosure. The composition may include the L-threonine dehydratase variant or elements capable of operating the L-threonine dehydratase variant, without limitation. The L-threonine dehydratase variant may be in a form included in a vector to express a gene operably linked thereto in a host cell.

The composition may further include a cryoprotectant or excipient. The cryoprotectant or excipient may be a substance which is not naturally occurring or a naturally occurring substance, without being limited thereto. As another specific example, the cryoprotectant or excipient may be a substance that does not naturally contact the microorganism or a substance that is not simultaneously included with the microorganism, without being limited thereto.

MODE FOR INVENTION

Hereinafter, the present disclosure will be described in more detail with reference to the following examples. However, the following examples are merely presented to exemplify the present disclosure, and the scope of the present disclosure is not limited thereto.

Example 1: Preparation of ilvA Variant (F383A) Plasmid Having L-Threonine Dehydratase Activity

In order to obtain a variant of the microorganism having enhanced L-isoleucine producing capability, mutation was induced in the microorganism according to the following method.

In order to amplify a gene encoding L-threonine dehydratase (TD), ilvA gene (SEQ ID NO: 2), a BamHI restriction enzyme site was inserted into both ends of primer (SEQ ID NOS: 11 and 12) for amplification from a promoter region (about 300 bp upstream from an initiation codon) to a terminator region (about 100 bp downstream from a termination codon) based on a reported ilvA sequence introduced with F383A mutation (World J Microbiol Biotechnol (2015) 31:1369-1377). Also, primers (SEQ ID NOS: 13 and 14) were used to introduce F383A mutation into the ilvA gene. Sequences of the primers used herein are listed in Table 1 below.

TABLE 1

SEQ ID NO:
Name
Sequence

11
primer 1
ggatccGACTGAGCCTGGGCAACTGG

12
primer 2
ggatccCCGTCACCGACACCTCCACA

13
primer 3
ACATCACGCTGgcaGAGTACCTCAA

14
primer 4
TTGAGGTACTCtgcCAGCGTGATGT

PCR was performed using a chromosome of wild-type Corynebacterium glutamicum ATCC 13032 as a template and primers of SEQ ID NOS: 11 and 14 and SEQ ID NOS: 12 and 13. The PCR was performed under the following conditions. After denaturation at 95° C. for 5 minutes, cycles of denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 90 seconds were repeated 30 times, and then polymerization was performed at 72° C. for 5 minutes.

As a result, a DNA fragment of a 1460 bp 5′ upstream region and a DNA fragment of a 276 bp 3′ downstream region with respect to the mutation of the ilvA gene were obtained.

PCR was performed using the two amplified DNA fragments as templates and primers of SEQ ID NOS: 11 and 12.

As a result, a DNA fragment of 1531 bp including ilvA mutation (SEQ ID NO: 7) in which phenylalanine at the 383^rdposition was substituted with alanine was amplified. The pECCG117 (Korean Patent No. 10-0057684) vector and the ilvA DNA fragment were treated with BamHI restriction enzyme and ligated with a DNA ligase, followed by cloning to obtain a plasmid named pECCG117-ilvA (F383A).

Example 2: Preparation of ilvA Variant Plasmid Having L-Threonine Dehydratase Activity

In order to obtain a variant of a gene encoding L-threonine dehydratase, an ilvA variant gene plasmid was prepared using a random mutagenesis kit (Agilent Technologies, USA). PCR was performed using the ilvA(F383A) chromosome of Example 1 as a template and primers of SEQ ID NOS: 11 and 12. The PCR was performed under the following conditions. After denaturation at 95° C. for 2 minutes, cycles of denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 90 seconds were repeated 30 times, and then polymerization was performed at 72° C. for 10 minutes.

As a result, a DNA fragment of 1531 bp including ilvA mutation capable of encoding L-threonine dehydratase having additional random mutation in addition to the mutation in which the phenylalanine at the 383^rdposition was substituted with alanine was amplified. The pECCG117 vector and the ilvA-mutated DNA fragment were treated with BamHI restriction enzyme and ligated with a DNA ligase, followed by cloning to obtain a plasmid.

Example 3: Preparation and Evaluation of Strain Belonging to the Genus Corynebacterium with L-Isoleucine Producing Capability

An L-isoleucine-producing strain was prepared using the wild-type Corynebacterium glutamicum ATCC13032. Specifically, in order to relieve feedback inhibition of threonine, which is a precursor of isoleucine in the biosynthesis pathway of L-isoleucine, arginine at the 407^thposition of horn gene encoding homoserine dehydrogenase was substituted with histidine (U.S. Patent Application Publication No. US 2020-0340022 A1, SEQ ID NO: 17).

More specifically, in order to prepare strains introduced with hom mutation (R407H), PCR was performed using the chromosome of Corynebacterium glutamicum ATCC13032 as a template and primers of SEQ ID NOS: 18 and 19 or SEQ ID NOS: 20 and 21, respectively. Sequences of the primers used herein are listed in Table 2 below.

TABLE 2

SEQ

ID

NO:
Name
Sequence

18
primer 5
TCGAGCTCGGTACCCCGCTTTTGCACTCATCGAGC

19
primer 6
CACGATCAGATGTGCATCATCAT

20
primer 7
ATGATGATGCACATCTGATCGTG

21
primer 8
CTCTAGAGGATCCCCGAGCATCTTCCAAAACCTTG

As a polymerase for PCR, a PfuUltra™ high-reliability DNA polymerase (Stratagene) was used, and the PCR conditions included denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and 28 repetitions of polymerization at 72° C. for 1 minute.

As a result, a DNA fragment of a 1000 bp 5′ upstream region and a DNA fragment of a 1000 bp 3′ downstream region with respect to the mutation of the horn gene were obtained.

PCR was performed using the two amplified DNA fragments as templates and primers of SEQ ID NOS: 18 and 21. The PCR was performed under the following conditions. After denaturation at 95° C. for 2 minutes, cycles of denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 2 minutes were repeated 28 times, and then polymerization was performed at 72° C. for 5 minutes.

As a result, a DNA fragment of 2 kb including mutation in the horn gene encoding the homoserine dehydrogenase variant in which arginine at the 407^thposition was substituted with histidine was amplified. The amplified product was purified using a PCR purification kit (QUIAGEN) and used as a DNA fragment to be inserted for preparation of a vector. After the purified amplification product was treated with smaI restriction enzyme, a pDZ vector (U.S. Pat. No. 9,109,242 B2) heat-treated at 65° C. for 20 minutes and the DNA fragment, as the amplification product, were mixed in a molar ratio (M) of 1:2 and cloned in accordance with manuals provided in an infusion cloning kit (TaKaRa) to prepare a pDZ-R407H vector for introduction of horn mutation (R407H) into the chromosome.

Corynebacterium glutamicum ATCC13032 was transformed with the prepared vector by electroporation and subjected to a second crossover process to obtain a strain including horn mutation (R407H) on the chromosome, and the strain was named Corynebacterium glutamicum ATCC13032 hom(R407H).

Example 4: Evaluation of L-Isoleucine Producing Capability of ilvA Variant-Introduced L-Isoleucine-Producing Strain

Strains were prepared according to the following method to identify L-isoleucine productivity of the variant obtained in Example 2. Specifically, the plasmid prepared in Example 1 was introduced into the Corynebacterium glutamicum ATCC 13032 hom(R407H) strain prepared in Example 3, and the prepared strain introduced with the plasmid was named ATCC13032 hom(R407H)/pECCG117-ilvA(F383A). In addition, the variant plasmid obtained in Example 2 was introduced into the Corynebacterium glutamicum ATCC13032 hom(R407H) strain, and an apoptosis rate measured after smearing the strain on a minimum medium was 70%. Surviving cells were inoculated onto and cultured in a seed medium to select a strain having superior isoleucine producing capability compared to that of the ATCC13032 hom(R407H)/pECCG117-ilvA(F383A) control, and the selected strain was named Corynebacterium glutamicum CJILE-301.

The strain was inoculated onto a 250 mL corner-baffle flask containing 25 mL of an isoleucine production medium and cultured at 32° C. for 60 hours while shaking at 200 rpm to prepare L-isoleucine. A composition of a production medium used herein is described below.

5% glucose, 1% bacto-peptone, 0.25% sodium chloride, 1% yeast extract, 0.4% urea, and pH 7.2

1.0% glucose, 0.4% ammonium sulfate, 0.04% magnesium sulfate, 0.1% monopotassium phosphate, 0.1% urea, 0.001% thiamine, 200 μg/L biotin, 2% agar, and pH 7.2

10% glucose, 0.2% yeast extract, 1.6% ammonium sulfate, 0.1% potassium phosphate, 0.1% magnesium sulfate heptahydrate, 10 mg/L ferrous sulfate heptahydrate, 10 mg/L manganese sulfate monohydrate, 200 μg/L biotin, and pH 7.2.

After culturing was completed, concentrations of L-isoleucine and L-threonine in the culture solution were measured using high-performance liquid chromatography (HPLC), and the results are shown in Table 3 below.

TABLE 3

L-Isoleucine
L-Threonine

Strain
concentration (g/L)
concentration (g/L)

ATCC13032 hom(R407H)/
2.5
1.5

pECCG117-ilvA(F383A) (parent strain)

CJILE-301 (strain)
4.3
0.0

As shown in Table 1, although the parent strain, Corynebacterium glutamicum ATCC13032 hom(R407H)/pECCG117-ilvA(F383A), produced L-isoleucine at a concentration of 2.5 g/L, the Corynebacterium glutamicum CJILE-301 strain, a variant according to the present disclosure, produced L-isoleucine at a concentration of 4.3 g/L, indicating that L-isoleucine productivity of the CJILE-301 strain increased compared to that of the parent strain by about 172%. In addition, the concentration of residual L-threonine decreased from 1.5 g/L to 0.0 g/L, indicating an increase in the activity of ilvA to threonine.

As a result of sequencing the ilvA gene by isolating the plasmid from the CJILE-301 strain, it was confirmed that A, the 1141^stbase of the base sequence of the ilvA gene, was substituted with G, and thus a protein variant in which T of the 381^stposition of the ilvA protein is substituted with A in addition to variation in which F of the 383^rdposition is substituted with A may be encoded thereby, and may be expressed as SEQ ID NO: 22.

This result indicates that the strain introduced with the ilvA variant (T381A) of Example 2 obtained by random mutation may produce L-isoleucine with high efficiency and high yield.

Example 5: Preparation of Strain Introduced with ilvA(T381A) and ilvA(T381A AND F383A) Variants with L-Threonine Dehydratase Activity

Primers of SEQ ID NOS: 31 and 32 for introduction of the ilvA variant (T381A and F383A) confirmed in Example 4 into the wild-type strain were prepared.

For preparation of the strain introduced with the ilvA variant (T381A and F383A), PCR was performed using the plasmid DNA extracted from the CJILE-301 strain of Example 4 as a template and primers of SEQ ID NOS: 31 and 32. Sequences of the primers used herein are listed in Table 4 below.

TABLE 4

SEQ

ID

NO:
Name
Sequence

31
primer 9
TCGAGCTCGGTACCCATGAGTGAAACATACGTGTC

32
primer 10
CTCTAGAGGATCCCCCGTCACCGACACCTCCACA

As a polymerase for PCR, a PfuUltra™ high-reliability DNA polymerase (Stratagene) was used, and the PCR conditions included denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and 28 repetitions of polymerization at 72° C. for 2 minutes.

As a result, gene fragments of 1411 bp including a terminator region of about 100 bp of the ilvA gene of 1311 bp were obtained.

The amplified product was purified using a PCR purification kit and used as a DNA fragment to be inserted for preparation of a vector. After the purified amplification product was treated with smaI restriction enzyme, the pDZ vector heat-treated at 65° C. for 20 minutes and the DNA fragment for insertion, as the amplification product, were mixed in a molar ratio (M) of 1:2 and cloned using the infusion cloning kit in accordance with provided manuals to prepare a pDZ-T381A F383A vector for introduction of T381A and F383A mutations into the chromosome.

Corynebacterium glutamicum ATCC13032 hom(R407H) was transformed with the prepared vector by electroporation and subjected to a second crossover process to obtain a strain including ilvA(T381A and F383A) mutation on the chromosome, and the strain was named CA10-3101.

The CA10-3101 strain was deposited under the Budapest Treaty to the Korean Culture Center of Microorganisms (KCCM) on May 27, 2020, with Accession No. KCCM12739P.

In addition, in order to identify isoleucine producing capability and threonine degrading effects of the ilvA(T381A) variant with single mutation, primers of SEQ ID NOS: 47 and 48 were prepared.

In order to prepare a strain introduced with the ilvA variant (T381A), PCR was performed using the genomic DNA of Cgl13032 as a template and primers of SEQ ID NOS: 31 and 48 and SEQ ID NOS: 32 and 47. In this regard, sequences of the primers used herein are as shown in Table 5 below.

TABLE 5

SEQ

ID

NO:
Name
Sequence

47
primer 47
CCGGATGATGACATCgctCTGTTTGAGTACCTC

48
primer 48
TCAAACAGagcGATGTCATCATCCGG

As a polymerase for PCR, a PfuUltra™ high-reliability DNA polymerase (Stratagene) was used, and the PCR conditions included denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and 28 repetitions of polymerization at 72° C. for 2 minutes.

As a result, gene fragments of 301 bp including a terminator region of about 100 bp of the ilvA gene of 1311 bp were obtained.

PCR was performed using the two amplified DNA fragments as templates and primers of SEQ ID NOS: 31 and 32. The PCR was performed under the following conditions. After denaturation at 95° C. for 10 minutes, cycles of denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 2 minutes were repeated 30 times, and then polymerization was performed at 72° C. for 10 minutes.

As a result, A 1411 bp gene fragment including a 1311 bp ilvA gene and a 100 bp terminator site was obtained.

The amplified product was purified using a PCR purification kit and used as a DNA fragment to be inserted for preparation of a vector. After the purified amplification product was treated with smaI restriction enzyme, the pDZ vector heat-treated at 65° C. for 20 minutes and the DNA fragment for insertion, as the amplification product, were mixed in a molar ratio (M) of 1:2 and cloned using the infusion cloning kit in accordance with provided manuals to prepare a pDZ-T381A vector for introduction of T381A mutation into the chromosome.

Corynebacterium glutamicum ATCC13032 hom(R407H) was transformed with the prepared vector by electroporation and subjected to a second crossover process to obtain a strain including ilvA(T381A) mutation on the chromosome, and the strain was named ATCC13032 hom(R407H) ilvA(T381A).

The strain was inoculated onto a 250 mL corner-baffle flask containing 25 mL of an isoleucine production medium and cultured at 32° C. for 60 hours while shaking at 200 rpm to prepare L-isoleucine. A composition of a production medium used herein is described below.

10% glucose, 0.2% yeast extract, 1.6% ammonium sulfate, 0.1% monopotassium phosphate, 0.1% magnesium sulfate heptahydrate, 10 mg/L ferrous sulfate heptahydrate, 10 mg/L manganese sulfate monohydrate, 200 μg/L biotin, and pH 7.2.

After culturing was completed, concentrations of L-isoleucine and L-threonine in the culture solution were measured using high-performance liquid chromatography (HPLC), and the results are shown in Table 6 below.

TABLE 6

Strain
L-Isoleucine (g/L)
L-Threonine (g/L)

ATCC13032 hom(R407H)
0.0
3.8

ATCC13032 hom(R407H) ilvA(WT)
0.0
3.7

ATCC13032 hom(R407H) ilvA(T381A)
0.5
3.3

CAW-3101 (ATCC13032 hom(R407H)
3.3
0.0

ilvA(T381A and F383A))

As shown in Table 6, although the parent strain, Corynebacterium glutamicum ATCC13032 hom(R407H), did not produce L-isoleucine, the ATCC13032 hom(R407H) ilvA(T381A) variant with single mutation produced L-isoleucine at a concentration of 0.5 g/L with a decreased amount of L-threonine, and thus it was confirmed that productivity of L-isoleucine was increased compared with the parent strain. Also, the ATCC13032 hom(R407H) ilvA(T381A and F383A) variant further including F383A mutation produced L-isoleucine at a concentration of 3.9 g/L, and thus it was confirmed that productivity of L-isoleucine considerably increased compared to the parent strain.

Example 6: Preparation of ilvA Variant Vector with L-Threonine Dehydratase Activity

Variants in which the amino acid at the ilvA mutation position with a high L-isoleucine productivity discovered in Example 1 above was substituted with different amino acids and effects thereof were identified. Specifically, 7 types of variants in which the amino acid at the 381^stposition of ilvA was substituted with different amino acids were prepared using the plasmid prepared in Example 3 as a template. The variants, substituted amino acids, and sequences of primers used in respective variants are shown in Table 7 below.

TABLE 7

Substituted

Gene
amino acid
Primer SEQ ID NO:

ilvA
T381S
SEQ ID NO: 3, 33/SEQ ID NO: 34, 4

T381P
SEQ ID NO: 3, 35/SEQ ID NO: 36, 4

T381Q
SEQ ID NO: 3, 37/SEQ ID NO: 38, 4

T381V
SEQ ID NO: 3, 39/SEQ ID NO: 40, 4

T381I
SEQ ID NO: 3, 41/SEQ ID NO: 42, 4

T381G
SEQ ID NO: 3, 43/SEQ ID NO: 44, 4

T381M
SEQ ID NO: 3, 45/SEQ ID NO: 46, 4

Sequences of the primers used in Table 7 are as shown in Table 8 below.

TABLE 8

SEQ ID NO:
Name
Sequence

33
primer 15
AGGTACTCtgcCAGggaGATGTCAT

34
primer 16
ATGACATCtccCTGgcaGAGTACCT

35
primer 21
AGGTACTCtgcCAGtggGATGTCAT

36
primer 22
ATGACATCccaCTGgcaGAGTACCT

37
primer 27
AGGTACTCtgcCAGctgGATGTCAT

38
primer 28
ATGACATCcagCTGgcaGAGTACCT

39
primer 33
AGGTACTCtgcCAGaacGATGTCAT

40
primer 34
ATGACATCgttCTGgcaGAGTACCT

41
primer 35
AGGTACTCtgcCAGgatGATGTCAT

42
primer 36
ATGACATCatcCTGgcaGAGTACCT

43
primer 41
AGGTACTCtgcCAGgccGATGTCAT

44
primer 42
ATGACATCggcCTGgcaGAGTACCT

45
primer 45
AGGTACTCtgcCAGcatGATGTCAT

46
primer 46
ATGACATCatgCTGgcaGAGTACCT

PCR was performed using the primers listed in Tables 7 and 8. Solg™ Pfu-X DNA polymerase (SolGent Co., Ltd.) was used as a polymerase, and the PCR was performed under the following conditions. After denaturation at 95° C. for 10 minutes, cycles of denaturation at 95° C. for 30 seconds, annealing at 55° C. for 30 seconds, and polymerization at 72° C. for 90 seconds were repeated 30 times, and then polymerization was performed at 72° C. for 5 minutes.